ID: 1050719299

View in Genome Browser
Species Human (GRCh38)
Location 9:8567156-8567178
Sequence GTTTGTGTTTTTTGCATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 2, 3: 71, 4: 797}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050719299_1050719305 26 Left 1050719299 9:8567156-8567178 CCAGAAATGCAAAAAACACAAAC 0: 1
1: 0
2: 2
3: 71
4: 797
Right 1050719305 9:8567205-8567227 TGGCGGTACCTGCCTTTTCCAGG No data
1050719299_1050719303 9 Left 1050719299 9:8567156-8567178 CCAGAAATGCAAAAAACACAAAC 0: 1
1: 0
2: 2
3: 71
4: 797
Right 1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG No data
1050719299_1050719302 6 Left 1050719299 9:8567156-8567178 CCAGAAATGCAAAAAACACAAAC 0: 1
1: 0
2: 2
3: 71
4: 797
Right 1050719302 9:8567185-8567207 GATGGGTTCCATGATGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050719299 Original CRISPR GTTTGTGTTTTTTGCATTTC TGG (reversed) Intronic
901110245 1:6787401-6787423 CTTTCTGTTTTTTGCTGTTCCGG + Intronic
901431754 1:9219899-9219921 GTTTGGATTTTTTGCTCTTCAGG + Intergenic
902323882 1:15685495-15685517 GTTTGTGTAATTTGAATTCCTGG + Intronic
903714936 1:25358321-25358343 ATTGGTGTTTTGTGTATTTCTGG + Intronic
905514920 1:38555608-38555630 CTTTGTGTTTATTGCAACTCTGG + Intergenic
907963761 1:59309335-59309357 GTTTGTATTCTTTGCATTACAGG + Intronic
908135866 1:61131782-61131804 GTATGTGATTTTTGCAGATCTGG + Intronic
908227746 1:62072999-62073021 GGTTGTGTCTTTTACATTTCAGG + Intronic
908232344 1:62118192-62118214 CTTTTTTTTTTTTTCATTTCTGG + Intronic
908372590 1:63498042-63498064 GTTTTTGTTTTATGTATTTTGGG - Intronic
908583128 1:65539063-65539085 GTTTTTTTTTTTTGCCTTTGGGG + Intronic
908649504 1:66316358-66316380 GTTTTTGTTTTTTGTTTTGCTGG - Intronic
908897090 1:68912641-68912663 GTTTTTTTTTTTTTAATTTCAGG - Intergenic
909027344 1:70497848-70497870 GTGTGTGTTTTTTTAATTACAGG + Intergenic
909318881 1:74257534-74257556 GTTTGTTTTTCTTTCATTTTTGG + Intronic
909378724 1:74972072-74972094 GTTTTTTTTTTTTAAATTTCTGG + Intergenic
909592571 1:77367312-77367334 ATTTATGCTTTTTGGATTTCTGG + Intronic
909722290 1:78788528-78788550 GTTTTCTTTTTATGCATTTCAGG - Intergenic
910167587 1:84344055-84344077 GTTTTTGTTTTTTGTTTTTTTGG + Intronic
910614750 1:89185079-89185101 GTTTGTTTTTTGTGGATGTCAGG + Exonic
912129632 1:106585817-106585839 GTTGGTGATTGATGCATTTCTGG - Intergenic
912661093 1:111531276-111531298 GTTTTTTTTTTTTTCTTTTCTGG - Intronic
912782104 1:112560401-112560423 GTTTTTGTTTTTTGGTTTTTGGG - Intronic
912965001 1:114229715-114229737 CTTTTTGTTCTTTGCATTTTAGG - Intergenic
913426187 1:118732933-118732955 TTTTTTGTATTTTGCATTTCAGG + Intergenic
914000241 1:143687996-143688018 TTTTTTTTTTTTTGCATTTTTGG + Intergenic
914720657 1:150286159-150286181 GTTTGTTTTTTCTTCATCTCTGG + Intronic
915067362 1:153237203-153237225 GTTCTTGATTTTTCCATTTCTGG - Intergenic
915696663 1:157749677-157749699 TTTTGTTTTATTTGCATTTCAGG - Exonic
915834402 1:159163728-159163750 GTTTTTTTTTTTTCCGTTTCAGG - Intergenic
916208601 1:162339704-162339726 GTGTGTGATTCTTGCATTTTGGG + Intronic
916809416 1:168292451-168292473 GTTTGCCTTTTTTTCATTTGAGG - Intronic
917113549 1:171577956-171577978 TTTTTTTTTTTTTGCATTTTTGG + Intronic
917377952 1:174370517-174370539 TTTTTTTTTTTTTACATTTCCGG + Intronic
917390267 1:174529264-174529286 CTTTCAGTTTTTTGAATTTCTGG + Intronic
917502814 1:175600817-175600839 TTTTCTGTTTTTTGCTTTTTGGG - Intronic
917564651 1:176200563-176200585 ATTTCTGTTTATTGTATTTCTGG - Intronic
917831307 1:178890881-178890903 TCTTGTGTTTTTCACATTTCAGG - Intronic
918292310 1:183120817-183120839 GTTTTTGTTTTTTGTTTTTTGGG + Intronic
918625318 1:186650379-186650401 TTTTTTTTTTTTTGCAGTTCTGG - Intergenic
918658594 1:187061023-187061045 GTTTTGGTTTTTTGAGTTTCAGG + Intergenic
918839093 1:189511523-189511545 TTTGGTGTTTCATGCATTTCTGG + Intergenic
919124094 1:193375752-193375774 ATTTAGGTTTATTGCATTTCTGG - Intergenic
919138179 1:193536731-193536753 GTTCCTGTTTTTTGCTTTTAAGG - Intergenic
919833481 1:201557961-201557983 GTTTTTGTTTTTTGGAGTCCAGG - Intergenic
919882658 1:201911078-201911100 GTTTGTGTTGTGTGCTTTGCAGG - Intronic
920338889 1:205263007-205263029 GTTTGTGGTTTTTGCATTCGAGG - Intronic
921921089 1:220670380-220670402 GATTGTGTTTTTTTTTTTTCTGG - Intergenic
921957892 1:221003120-221003142 GTTTGTATTTTTTGCAGATACGG - Intergenic
922156588 1:223044914-223044936 ATTTTTGTTTTTTGCGTTTTGGG - Intergenic
923295480 1:232590884-232590906 GTTTGTATTGTCTGCATTTTAGG - Intergenic
923475577 1:234328170-234328192 GTTTGTGTGTTTTAACTTTCTGG + Intergenic
923682994 1:236134137-236134159 GTTTGTCTTTCTTACATATCTGG - Intergenic
924188109 1:241518228-241518250 GTTTTTGTTTTTTCTAGTTCTGG - Intronic
924394241 1:243601643-243601665 GTTTGGGTTCTTTACATTTTGGG - Intronic
1063106731 10:2998629-2998651 GTTTGTGTTTTTATCATTGGTGG - Intergenic
1063493192 10:6483896-6483918 GCTTGTGTATTTTGCATATATGG - Intronic
1063684884 10:8227602-8227624 GTTTTTTTTTTTTCCATTTTGGG + Intergenic
1063926872 10:10987255-10987277 CTTTTTTTTTTTTTCATTTCTGG + Intergenic
1064025720 10:11847262-11847284 GTTAGTGGTTTTTGAATTTGGGG - Intronic
1064180807 10:13112908-13112930 GTGTGGGTTTTTTCCTTTTCTGG - Intronic
1064507629 10:16050373-16050395 TTTTTTTTTTTTTGCATATCTGG - Intergenic
1064708851 10:18101958-18101980 GTTTGTGTCTTCTGAAATTCAGG + Intergenic
1065329332 10:24577875-24577897 GTTTGTGTGTTTTTCATTCTTGG - Intergenic
1065353771 10:24819217-24819239 GTTTTTGTTTTTTGTTTTTGGGG - Intergenic
1065412809 10:25448528-25448550 ATTTGTGTTGTTTCCATTTTTGG + Intronic
1065693377 10:28357552-28357574 TTTTGTGTTTTTAGCAGTTGGGG + Intergenic
1065748455 10:28863248-28863270 TTTTGTATTTTTTGTATTTTTGG + Intronic
1065767696 10:29046961-29046983 CTTTTTTTTTTTTGTATTTCTGG + Intergenic
1066204102 10:33170674-33170696 TTTTGTGTTTCTTGGATTTCAGG + Intergenic
1067040227 10:42948008-42948030 GTTTTGGTTTTTTGCTTTTTTGG - Intergenic
1067280526 10:44868484-44868506 TTTTTTTTTTTTTGCATTTTGGG - Intergenic
1067397944 10:45941406-45941428 GCTTTTGTTTTTTGCATCTGTGG - Intergenic
1067530535 10:47068487-47068509 ATTTGTGTTTTTTTGATTGCTGG + Intergenic
1067797975 10:49334435-49334457 GTGTGTGTTTTTTGGTTTTTTGG + Intergenic
1067866262 10:49910499-49910521 GCTTTTGTTTTTTGCATCTGTGG - Intronic
1068081096 10:52318229-52318251 GTTTGTTGTTTTTGTGTTTCTGG + Intergenic
1068378556 10:56216323-56216345 GTTTGTTTTTTTTGAAATTCAGG + Intergenic
1068483405 10:57624784-57624806 GTGTGTGCTTTTTCCTTTTCTGG + Intergenic
1068645908 10:59467427-59467449 GTTGGTGTTCTCTGAATTTCTGG - Intergenic
1069172555 10:65252135-65252157 GTTGGTGTTTCTTACATTTTAGG - Intergenic
1069221677 10:65891330-65891352 CTTTGTGTTTTTTTTCTTTCTGG + Intergenic
1069286027 10:66716625-66716647 GTTTGTGTTTTTGTCATATGTGG + Intronic
1070549317 10:77478410-77478432 GTTTGTGTTTGGAGCATTCCTGG - Intronic
1071089888 10:81905822-81905844 GTTTGTGTTTTTTGCATAATTGG + Intronic
1071312950 10:84361071-84361093 GTTTGTGTTTGTTCCAGTGCAGG + Intronic
1071419089 10:85471843-85471865 TTTTGTGTTTGTTCCATTTTTGG - Intergenic
1071779601 10:88828747-88828769 GTTTGTGCTTTTTGTTTTTCCGG + Intronic
1071832797 10:89388785-89388807 TTTTTTTTTTTTTACATTTCAGG - Intronic
1071918818 10:90326495-90326517 TTTTGTGTTTTTTTTTTTTCAGG + Intergenic
1072062372 10:91826295-91826317 TTTGGAGTATTTTGCATTTCAGG + Intronic
1072517780 10:96202758-96202780 GTTTGTGGTTTCTGCAGTTCTGG + Intronic
1072906763 10:99461283-99461305 ATGTGTCTTTTTTGCAGTTCTGG - Intergenic
1072978981 10:100083908-100083930 TTATGTGTTTTTTTCATGTCTGG - Intergenic
1073722469 10:106188685-106188707 TTTTTTTTTTTTTACATTTCTGG - Intergenic
1073898659 10:108193247-108193269 GTTAGTATTTTTAGCATTCCAGG + Intergenic
1073900850 10:108218931-108218953 TTCAGTGTTTTTTACATTTCGGG - Intergenic
1074094126 10:110293455-110293477 TTTTTTGTTTTTTCCATTTACGG - Exonic
1074354828 10:112773449-112773471 GTTTGTGTTTCTGGAATTTGTGG - Intronic
1074571515 10:114628613-114628635 GTTTGTGTTGTTTGGTTTCCTGG - Intronic
1074784149 10:116824474-116824496 GTTTGGGTTGTTTTCATTTTGGG - Intergenic
1074919367 10:117991876-117991898 GTTTGGGGTTTTAGAATTTCCGG + Intergenic
1075199644 10:120391943-120391965 GTCTGGTTTCTTTGCATTTCTGG - Intergenic
1075916125 10:126169062-126169084 GAATGTGTTTTTTGCTTTTTGGG - Intronic
1076465057 10:130673941-130673963 GTATGTGTTTTTAACATTTTGGG + Intergenic
1076766037 10:132633771-132633793 GAATGTGTTTTTTGGGTTTCTGG + Intronic
1077004259 11:344418-344440 GTTTATCTTTTTAGCAGTTCAGG - Intergenic
1077062190 11:622446-622468 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
1078239503 11:9517757-9517779 GATTCTGAGTTTTGCATTTCAGG - Intronic
1078256900 11:9665780-9665802 ATTTGTGTTATTTCCAGTTCGGG + Intronic
1078433333 11:11304089-11304111 GTCTGTGTCTTTTCCTTTTCAGG - Intronic
1078555279 11:12320381-12320403 GTTTGTGTTTTTTTAATCTATGG - Intronic
1078742941 11:14085015-14085037 GTTTGAGTTCTTTGTAATTCTGG + Intronic
1079184317 11:18222353-18222375 GTTTTTTTTTTTTGTATTTTTGG - Intronic
1079622704 11:22573394-22573416 CTTTGTGCTTTTGGCATTTCAGG + Intergenic
1079738655 11:24030072-24030094 GTCTCTGTTTTTTTCTTTTCCGG - Intergenic
1079770817 11:24457168-24457190 GTTTCTCTTTTGTGGATTTCTGG - Intergenic
1079916843 11:26379618-26379640 TTTTTTCTTTTTTGCATTTTTGG - Intronic
1080149934 11:29039868-29039890 GTTTCTATTTTGTGTATTTCTGG + Intergenic
1080373273 11:31677245-31677267 GTTTGTCTGTTTTGCAATTATGG + Intronic
1080971775 11:37286243-37286265 GTTTGTTTTTTTTTTTTTTCTGG + Intergenic
1081185449 11:40036872-40036894 GTTTGTGTTTTTTGCTACACAGG + Intergenic
1081195669 11:40157376-40157398 CTTTGTTTTTATTGCATTTTTGG - Intronic
1081447625 11:43145851-43145873 GTTTTTGTTTTTTGAATCTGAGG + Intergenic
1081466109 11:43319260-43319282 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
1081506972 11:43727915-43727937 TTTTTTGTTTGTTTCATTTCTGG + Intronic
1082057604 11:47832498-47832520 TTTTCAGTTTTTTACATTTCTGG + Intronic
1082726536 11:56743551-56743573 ATCTGTCTTTTTTGGATTTCTGG - Exonic
1082957592 11:58886731-58886753 GTGTGTGTTTTATGCATATCTGG + Intronic
1082958770 11:58899403-58899425 GTTTTTGTTTTTTTAATTTTTGG - Intronic
1083943271 11:65910155-65910177 TTTTTTGTTTTTTGTTTTTCTGG - Intergenic
1083952026 11:65961876-65961898 GCTTGTGTTTTTTGTGTTCCCGG - Exonic
1084598254 11:70130091-70130113 GTGTTTGTTTTTTGACTTTCTGG - Intronic
1084710516 11:70841099-70841121 TTTTGTTTTTTTTGTATTTTTGG - Intronic
1085471364 11:76760357-76760379 GTTTTTGTTTTTTGTCTTTTGGG - Intergenic
1085667044 11:78423166-78423188 GTTTTTGTTTTTAAGATTTCGGG - Intergenic
1085874799 11:80393187-80393209 GTATGTGTTTTATGCTTTTCTGG - Intergenic
1085934867 11:81128760-81128782 GTTTATGTTTTATGTATTTAAGG - Intergenic
1086044442 11:82516564-82516586 GCTTGTGTGTTTTTCTTTTCAGG - Intergenic
1086812417 11:91326927-91326949 TTTTTTTTTTTTTGCATTTTGGG - Intergenic
1086877631 11:92115938-92115960 GTTTGAATTCTTTGAATTTCTGG - Intergenic
1087306611 11:96496836-96496858 TTTTCTGTTCTTTGCCTTTCAGG - Intronic
1087534076 11:99421618-99421640 TTATGACTTTTTTGCATTTCTGG + Intronic
1087880757 11:103413337-103413359 ATTTGTATTTTTTTCATTTAAGG + Intronic
1088782058 11:113145308-113145330 GTTTGTGCTTTTTATATTTAGGG - Intronic
1089724646 11:120465209-120465231 TTTTGTGTTCTTTGCATTCTTGG + Intronic
1090004746 11:122991457-122991479 ATTTGTTTGTTATGCATTTCTGG - Intergenic
1090753486 11:129767454-129767476 TTTTTTTTTTTTTGCATGTCTGG - Intergenic
1091594978 12:1872140-1872162 GGTTGTGTTTTTAACATTTTTGG + Intronic
1091608491 12:1979946-1979968 GTTTGTTTTTTTTAATTTTCTGG - Intronic
1091683665 12:2545720-2545742 AATTGTGTTTTTTGCATTGTTGG - Intronic
1093260686 12:16933762-16933784 ATTTGTGTTGTTTACATATCTGG + Intergenic
1093472172 12:19513986-19514008 GTTTCTGTTTTTTGTTTTTTTGG + Intronic
1093849510 12:24018626-24018648 GTTTTTGTATTTTGTATTTTTGG - Intergenic
1094718592 12:33037904-33037926 GTTTTTGGTTTTTGCAACTCAGG + Intergenic
1095193214 12:39282990-39283012 GTTTTTTTTTTTTGTATGTCAGG - Intergenic
1095236856 12:39807021-39807043 TAATGTGTTTTTTTCATTTCTGG - Intronic
1095295929 12:40527410-40527432 GTTTGTGTTTATTTTATTTAGGG + Intronic
1095393701 12:41739740-41739762 TTTTATGTTATTTGCCTTTCTGG - Intergenic
1095565239 12:43615374-43615396 GTTTTTGTTCTTTTCATTTTTGG + Intergenic
1095771878 12:45968935-45968957 GTTTTTGTTTTTTGCGTTTTTGG - Intronic
1095785495 12:46104796-46104818 CTTTGTGATTTTTGCTTTCCAGG + Intergenic
1095826339 12:46533705-46533727 GTCAGTGTTTTATTCATTTCAGG + Intergenic
1097077293 12:56404610-56404632 GTTGGGGTTTGGTGCATTTCTGG + Intergenic
1097077351 12:56405274-56405296 GTTGGTGATTGGTGCATTTCTGG - Intergenic
1097252106 12:57640976-57640998 GTTTGGTTTTTATGCATTTTAGG - Intergenic
1097502363 12:60420335-60420357 GTTTGTGTATTTTGTTTCTCTGG - Intergenic
1097713422 12:62939041-62939063 CTTAGTCTTTTTTGCCTTTCGGG - Intergenic
1097843053 12:64340531-64340553 GTTGGGGATTGTTGCATTTCTGG - Intronic
1097882775 12:64700997-64701019 GTTTTTGTTTTTTGTCTTTTGGG + Intergenic
1097918664 12:65047440-65047462 GTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1098166482 12:67703660-67703682 GTTTTTTTTTTTTTAATTTCAGG - Intergenic
1098242497 12:68482536-68482558 GTTTCTGTTTTGTGCAGTGCAGG - Intergenic
1098274686 12:68801431-68801453 GTTTTTGTTTTTTGTTTTTTGGG - Intergenic
1098300371 12:69048044-69048066 TTTTGTTTTTTTAGCATTCCAGG - Intergenic
1098344738 12:69489816-69489838 GTTTTTTTTTTTGGCTTTTCTGG + Intronic
1098452482 12:70635575-70635597 GTTTGTTTGTTTTACATTTAAGG - Intronic
1098568653 12:71963988-71964010 GTTTCTCCTTTTTGCTTTTCAGG - Intronic
1099047676 12:77743051-77743073 GATTGAGATTTTTGCAGTTCGGG + Intergenic
1099073619 12:78077936-78077958 GTTTCTGTTTTTTGTTTTTGAGG - Intronic
1099465546 12:82982440-82982462 TTTTTTTTTTTTTGCATTTTAGG + Intronic
1099467777 12:83008208-83008230 CTTTGAGTTTTTTGAATCTCTGG + Intronic
1099530508 12:83774112-83774134 GTTTGTTTTTGTTACATTTTGGG + Intergenic
1099927165 12:89032344-89032366 TTTTTTTTTTTTTGTATTTCTGG - Intergenic
1100863848 12:98834666-98834688 CTTAGTGATTTTTGCATATCTGG + Intronic
1101078641 12:101158430-101158452 CTTTGTGTTTTTTGAATGTATGG - Intronic
1101503054 12:105321568-105321590 GTTTCTGTTGTTTGCATCCCAGG + Intronic
1101510192 12:105385920-105385942 TTTTGTTTTTTTTGCTTTTTTGG - Intronic
1101539186 12:105649494-105649516 GCTAGTGTATTTTTCATTTCAGG - Intergenic
1102676368 12:114662098-114662120 TTTTTTTTTTTTTGTATTTCTGG - Intergenic
1103105876 12:118224430-118224452 GTTTGTGTTTTGTTCTTTCCTGG + Intronic
1103305071 12:119957595-119957617 TTTTCAGGTTTTTGCATTTCTGG - Intergenic
1104183697 12:126407876-126407898 GTTTCTTTTTTTTCCATTTCAGG + Intergenic
1104398116 12:128452743-128452765 GAATGTGATTTGTGCATTTCTGG + Intronic
1105263911 13:18800073-18800095 GTTTGTGTTTTGTTCTTCTCTGG - Intergenic
1105540895 13:21315759-21315781 GTTTGACATTTTTGGATTTCAGG + Intergenic
1105815112 13:24028845-24028867 ATTTGTGTTTTTTATGTTTCTGG + Intronic
1106645773 13:31632246-31632268 GTTTGTTTGTTTTGCTTTTGAGG - Intergenic
1106923793 13:34591846-34591868 GTTTGTTTTTTTTTTATTTTTGG + Intergenic
1107754224 13:43601551-43601573 GTTTGTGCTTTTGGCTTTTGAGG - Intronic
1107931844 13:45313475-45313497 GTTTGTTTGTTTTGTATTTTTGG + Intergenic
1107979277 13:45718884-45718906 ATTTGGGTTTTATGCATTTTAGG - Intergenic
1108410908 13:50145868-50145890 GTTTCTGTTTTTTTCACTTGGGG + Intronic
1108486145 13:50927860-50927882 GTTTTTGTTTTTTTAAATTCTGG - Intronic
1109031260 13:57191971-57191993 GTTTGTTTGTTTTGCTTTTCCGG - Intergenic
1109224912 13:59681601-59681623 GTGTTTTTTTTTTCCATTTCAGG + Intronic
1109962031 13:69644171-69644193 TTTTGTTTTTTTTGTATTTTTGG - Intergenic
1110090423 13:71439257-71439279 CTCTTTGTTTTTTGCATATCTGG - Intronic
1110128960 13:71982625-71982647 TTTTTTTTTTTTTGTATTTCTGG + Intergenic
1110321748 13:74168182-74168204 GTTTGAATTCTTTGCATCTCTGG + Intergenic
1110493976 13:76143560-76143582 CTTTGTCTTTTTTGCCTTTGTGG + Intergenic
1110917623 13:81042937-81042959 TTTTGTTTTTTTAGCATTTGTGG + Intergenic
1111434551 13:88189670-88189692 GTGTGTGTTTTTTAATTTTCAGG - Intergenic
1111570753 13:90081663-90081685 GTTTATATGTATTGCATTTCCGG - Intergenic
1112064638 13:95780238-95780260 GGGTGTGTGTTTTGCACTTCAGG + Intronic
1112291247 13:98145032-98145054 GTTTGTGTTTTTAGAATGTCTGG + Intronic
1112722335 13:102259099-102259121 GATCATGTTATTTGCATTTCAGG - Intronic
1113064809 13:106362016-106362038 GTTTTTGTTTTTCCCAATTCAGG - Intergenic
1113184003 13:107665410-107665432 GTTTTTGTTTTTTACAATACAGG + Intronic
1113540848 13:111107929-111107951 GTTTTTGTTTTTTGTAGTTTTGG + Intergenic
1113646345 13:111999308-111999330 GTTTGTGTTTTCTGTGTTTGTGG - Intergenic
1114700025 14:24667470-24667492 GCTTCTCTTTTTTGCATTTCAGG - Intergenic
1115628175 14:35216281-35216303 GTTTTTGTCTTTTTCCTTTCTGG + Intronic
1116276265 14:42837025-42837047 GTTTTTTTTTTTTCCAGTTCTGG - Intergenic
1116426313 14:44796257-44796279 CTTTTTGATTTTTACATTTCTGG + Intergenic
1116987336 14:51235334-51235356 GTTTGTGTTTCATGTATTTTGGG - Intergenic
1117167416 14:53050911-53050933 ATTTATGTTTTTTGCATTTTTGG - Intronic
1117169465 14:53078039-53078061 GTTTGTGTTGCTTCCATTTTTGG + Intronic
1117187014 14:53250110-53250132 GTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1117228619 14:53691466-53691488 GTTTGTGTTGTTTGCACCTTGGG - Intergenic
1117398558 14:55336815-55336837 ATTTTTTTTTTTTACATTTCTGG - Intronic
1118543100 14:66853083-66853105 GTTTGTTTCTGTTGCATTTGGGG + Intronic
1119243642 14:73084551-73084573 GTTTGTGTTTTTTATTTTTTTGG + Intronic
1119905902 14:78301775-78301797 ATTTGAGTTTTATGCTTTTCTGG + Intronic
1120240534 14:81944652-81944674 GTTTTTTTTTTTGGCAATTCAGG - Intergenic
1120391760 14:83917831-83917853 GTTTTTGCTTTTTGTATTTGAGG - Intergenic
1120433767 14:84453459-84453481 GTTTTAGTTTTTTTCATCTCCGG - Intergenic
1120544981 14:85800089-85800111 GCTTGTGTTTTGTTAATTTCTGG - Intergenic
1120825633 14:88952347-88952369 TGCTGTGTTTTTGGCATTTCTGG + Intergenic
1121183436 14:91946873-91946895 GTATGTATTTTTTAAATTTCGGG - Intronic
1121480723 14:94269654-94269676 GTTTTTGTTTTTTTTTTTTCTGG - Intronic
1121617072 14:95320143-95320165 GCTTGTGTTTTTTTTCTTTCCGG + Intergenic
1121863254 14:97339043-97339065 CTTTGACTTTTTTGCATTTCAGG - Intergenic
1121901960 14:97701359-97701381 ATTTGTGTTGTTTCCATTTGGGG - Intergenic
1122123255 14:99565793-99565815 ATTTGTGTTTGTTGCTCTTCTGG - Intronic
1124064492 15:26327911-26327933 TTTTTTTTTTTTTGCATTTGGGG - Intergenic
1124778417 15:32606741-32606763 GATTTTTTTTTTTTCATTTCTGG - Exonic
1124866359 15:33495983-33496005 GTGTGTGTAGTTTGTATTTCAGG - Intronic
1125282877 15:38061621-38061643 GTTTTTGTTTTTTGTTTTTTAGG + Intergenic
1125742793 15:41978887-41978909 GTTTTTGTTTTTTGCATGGGTGG - Intergenic
1126001632 15:44216392-44216414 GTTTTTGTTTTTTTTATTTGGGG + Intergenic
1126258533 15:46657802-46657824 GTGTGTGTGTGTTTCATTTCAGG + Intergenic
1126524447 15:49635453-49635475 TTTTTTGTTTTTTGCCTTACAGG + Intronic
1126831030 15:52605485-52605507 ATTTGGGATTTTTGCATTTGGGG - Intronic
1126986897 15:54321917-54321939 CTTTATGTTTTTTGTCTTTCAGG + Exonic
1127242389 15:57131264-57131286 CTTTATGTTTTTTCCATTTCTGG + Intronic
1128038390 15:64547330-64547352 GTTTGGATTTTTTGGTTTTCTGG + Intronic
1128802664 15:70506762-70506784 TTTTCAGTTTTTTGCATGTCTGG + Intergenic
1128810156 15:70565516-70565538 GTTTGGGTTTTTTTCTTTTTAGG + Intergenic
1129092082 15:73162037-73162059 GTTTGATTTTTGTGCATTTTTGG + Intronic
1129094868 15:73195409-73195431 GTCTGTGTGTTTTTCATTTTAGG + Intronic
1130786928 15:87108930-87108952 ATTTTTTTTTTTTGTATTTCTGG - Intergenic
1131927340 15:97400213-97400235 GTCTTTATTTTTTTCATTTCTGG + Intergenic
1132084968 15:98900833-98900855 GTTTGTGTTTCTGGAATCTCGGG + Intronic
1132968699 16:2674052-2674074 GCTTGTGTTTTTTGTATTTTAGG + Intergenic
1133981906 16:10639279-10639301 GTTTTTGTTTTTTGGACTCCAGG - Intronic
1134375510 16:13669080-13669102 GTTTCTGTTTTCTAAATTTCAGG - Intergenic
1134443391 16:14312762-14312784 TTTTTTTTTTTTTGTATTTCTGG - Intergenic
1134666080 16:16019713-16019735 TTTTGTGCTTTCTGCATTCCTGG + Intronic
1135078102 16:19411238-19411260 ATTTGTGTGTTGTGCATCTCTGG + Intronic
1135338481 16:21625764-21625786 GTTTGTGTGGTTTGCATTTTAGG + Intronic
1135527000 16:23220881-23220903 GATTTTGTTTTTTGCTTTTTGGG - Intergenic
1135618950 16:23936592-23936614 TTTTTTTTTTTTTGCATTTTTGG + Intronic
1135829246 16:25758991-25759013 TTTTTTGTTTTTTGTTTTTCTGG - Intronic
1135983977 16:27170104-27170126 TTTTGTGTTTTTTTTATTTGTGG - Intergenic
1136010732 16:27362048-27362070 GTCTGTGTCTTTGGGATTTCGGG - Intronic
1136291707 16:29276916-29276938 GTTTGGGGTTTTTCCATTTTTGG + Intergenic
1136767393 16:32797077-32797099 GTTTGTGCTCTTTTCATTTTGGG + Intergenic
1136800755 16:33073624-33073646 GTTTGTGCTCTTTTCATTTTGGG - Intergenic
1137850099 16:51733179-51733201 TTTTTTGTTTTTTTCATTTTGGG + Intergenic
1138050474 16:53771695-53771717 GTTTGGGTTTTTTCCACTTTTGG - Intronic
1138086954 16:54142127-54142149 TTTTTTGTTTTTTGTATTTTTGG - Intergenic
1138150527 16:54652453-54652475 GTTTTTGTTTTTATCATTTGTGG - Intergenic
1138404685 16:56780808-56780830 GTTTGTGGTTTTTGTTTTTGAGG + Intronic
1138619825 16:58201894-58201916 GCTTTTGTTTTTTGGATTTTTGG - Intergenic
1138776853 16:59733843-59733865 TTTTGTTTTATTTGAATTTCAGG + Intronic
1138779932 16:59771478-59771500 ATTTGTGACTTTTACATTTCAGG - Intergenic
1139325266 16:66147821-66147843 GTGTGTCTGTTTTGCATTTCTGG - Intergenic
1139397885 16:66654981-66655003 CTTTTTGTTTTTTGGGTTTCGGG + Intronic
1140503309 16:75453442-75453464 GTTTGGGTTTTTTGGTTTTTGGG - Intronic
1140863258 16:79037727-79037749 GTTGGTTTTGTTTGCATTTCTGG + Intronic
1140964515 16:79951986-79952008 GTTTTTGTTGTTTGCATTTTAGG - Intergenic
1141473905 16:84258978-84259000 GTTTATTTTTTTTACATTCCAGG + Intergenic
1141698819 16:85633141-85633163 TTTTCTGTTTTTAGCATCTCCGG + Intronic
1141808456 16:86357911-86357933 GCTGGTGATTTTTGCATTCCAGG - Intergenic
1141912193 16:87067590-87067612 GTTTATTTTTTTGGCATTTTAGG - Intergenic
1203069787 16_KI270728v1_random:1059099-1059121 GTTTGTGCTCTTTTCATTTTGGG + Intergenic
1142694246 17:1624578-1624600 GTTTTTGTTTTTGGGATTACAGG - Intronic
1143463400 17:7118740-7118762 GTTCTTTTATTTTGCATTTCTGG + Intergenic
1144417710 17:15067835-15067857 GTTTCTGTTACTTGCATTTCAGG + Intergenic
1144646161 17:16975088-16975110 TTTTGTTTGTTTTTCATTTCAGG - Intergenic
1145885366 17:28378630-28378652 GTTTTTGTTTTTTGTTTTTTGGG + Intronic
1146086140 17:29831739-29831761 GTTTTTTTTTTTTGTATTTGTGG + Intronic
1146104337 17:30018458-30018480 TATTGTTTTTTTTTCATTTCAGG + Intronic
1147226340 17:38980859-38980881 TTTTTTCTTTTATGCATTTCTGG + Intergenic
1147706390 17:42428034-42428056 GTTTTTGTTTTTTGCTTTTGAGG + Intergenic
1148302190 17:46558058-46558080 GTTTGTTTTTTTTTCTTTTAAGG + Intronic
1148960341 17:51387222-51387244 TTGTTTTTTTTTTGCATTTCTGG + Intergenic
1149759298 17:59215039-59215061 GTTTTTGTTTTTGGTATTTGTGG + Exonic
1149904005 17:60508463-60508485 GTTTGTGTTTTCTTAATTTTTGG - Intronic
1150574836 17:66421320-66421342 GTTTCAGGTTTTTGCCTTTCTGG + Intronic
1150824306 17:68461186-68461208 GTTTGTTTGTTTTGTTTTTCAGG - Intergenic
1151020622 17:70612904-70612926 CTTTGTGGTCTTTGCATTTCAGG - Intergenic
1151029196 17:70716146-70716168 GTTTTTTTTTTTTTCATTTTTGG + Intergenic
1151316021 17:73323242-73323264 GTTTTTTTTTTTTGCATTTTTGG + Intergenic
1152284806 17:79406098-79406120 GTTTGGGCTGTTTCCATTTCTGG + Intronic
1153341622 18:3980612-3980634 GTTTTGGTTTTTTTCCTTTCCGG - Intronic
1153593985 18:6705062-6705084 GTTTGAGTTCTTTGTGTTTCTGG - Intergenic
1153693660 18:7618545-7618567 TTTTGGGTTTTTTTCCTTTCAGG - Intronic
1153733148 18:8035695-8035717 GTTTGTGTTTATTTCTTTTGTGG - Intronic
1153902207 18:9627588-9627610 TTTTGAGTTTTTTGCTATTCTGG - Intergenic
1153977189 18:10279952-10279974 GTGTTTGTTTTTTTCATCTCTGG + Intergenic
1155055393 18:22177393-22177415 GTTTTTGTTTTTGTCATTTACGG - Intronic
1155199871 18:23507963-23507985 GTCTGTGTGTTTTTCCTTTCAGG + Exonic
1155202466 18:23529157-23529179 GTTTGTGGTTTTTTTCTTTCAGG + Exonic
1155264746 18:24080468-24080490 TTTTATGTTTTTTACATTTTTGG + Intronic
1155332902 18:24735825-24735847 GTTTGTGTTTTTTGTGTTGTGGG + Intergenic
1155654753 18:28178954-28178976 GTTTTTGTTTTTTCTAATTCTGG + Intergenic
1155920129 18:31595293-31595315 GTTTTTGCTTTTGGCATTCCAGG + Intronic
1155988415 18:32254731-32254753 CTTTGGGTGTGTTGCATTTCAGG - Intronic
1156056891 18:33016308-33016330 GTTTTTGTTTTTTGCTGATCTGG - Intronic
1156749555 18:40434903-40434925 GTTTTTGTTTTTTACACCTCTGG + Intergenic
1157000427 18:43516257-43516279 TTTTTTGTTTTTTGTTTTTCTGG + Intergenic
1157232652 18:45933339-45933361 GTTTCTGTTTTTTTCTTTTATGG - Intronic
1157239417 18:45995804-45995826 GGTTTTGTTTTTTGCTTTTTGGG + Intronic
1157598788 18:48879929-48879951 GTTTTTGTGTTTTGTTTTTCTGG + Intergenic
1157908485 18:51592462-51592484 GTTGGGGTTTTTTACATTACTGG - Intergenic
1157955637 18:52094557-52094579 GTTTCTGTTTTCTGCATATGCGG + Intergenic
1158147740 18:54335073-54335095 GTTTGTGTTTTCTCCATCTTAGG - Intronic
1158232775 18:55277608-55277630 TTTTTTTTTTTTTGCTTTTCGGG + Intronic
1158525993 18:58214223-58214245 ATTTGTTTCTTTTGAATTTCTGG + Intronic
1158794941 18:60834016-60834038 GTTTTGTTTTTTTGCTTTTCTGG + Intergenic
1158919710 18:62177817-62177839 GTTTTTGTTTTAGGCATTTAAGG - Intronic
1159049418 18:63405596-63405618 ATTTGTTTGTTTTACATTTCTGG + Intronic
1159452040 18:68614751-68614773 GTTTGTGATTTTTGTACTTTAGG - Intergenic
1159723107 18:71918478-71918500 GTTTTTGTATTATGCTTTTCAGG + Intergenic
1161161520 19:2764299-2764321 GGTTGTGTTTTTTGAATGTGTGG - Intronic
1161230131 19:3170593-3170615 TTTTTTTTTTTTTGCATTTTTGG - Intergenic
1161600111 19:5176862-5176884 GTTTGTTTGTTTTGTATTTTTGG - Intronic
1161805352 19:6440358-6440380 GTTTTTGTTTTTTGCATCATTGG + Exonic
1162499525 19:11043972-11043994 GTTTTTGTTTTTTGTTTTTCAGG - Intronic
1162821798 19:13227537-13227559 GTTTTTGTTTTTTTCATTTTCGG - Intronic
1163129010 19:15260442-15260464 AGTTGTGTTTGTGGCATTTCAGG - Intronic
1163293910 19:16399658-16399680 GTTCCTGTTTTTTGCTTTTTGGG + Intronic
1164027101 19:21362337-21362359 GTTTTTGTTGTTTGTCTTTCGGG - Intronic
1164177269 19:22786252-22786274 GTTTGTTTGTTTTGCATATGTGG + Intergenic
1165191715 19:34069168-34069190 GTTTTTGTTTTTTGTTTTTTGGG + Intergenic
1165330310 19:35138317-35138339 GTGTGTGTGTGGTGCATTTCTGG + Intronic
1166938276 19:46347932-46347954 GTTTTTTTTTTTTTCATGTCTGG - Intronic
1167179501 19:47891793-47891815 GTTTGGGTTCTTTCCATGTCTGG + Intergenic
1167895707 19:52579133-52579155 TTCTGTGTATGTTGCATTTCTGG - Intronic
1167932258 19:52875480-52875502 ATTTGTGATTTTTACATTTTTGG + Intronic
1167945166 19:52982364-52982386 GCTTTTGTTTTTTACATTTTTGG + Intergenic
924961963 2:43834-43856 TTTTGTTTGTTTTCCATTTCTGG + Intronic
925526013 2:4803170-4803192 GTTTTTGTCTTTTGCTTTTTTGG - Intergenic
925625835 2:5841598-5841620 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
925806855 2:7659111-7659133 TTTTGTGTTTTTTGTTTTTAAGG + Intergenic
926220144 2:10930864-10930886 GTATGTATTTTAGGCATTTCTGG + Intergenic
926863027 2:17328716-17328738 GTGTGTGTTCTTTGAATGTCAGG - Intergenic
928559808 2:32468975-32468997 GTGTGTTTTTTTTGGGTTTCTGG + Intronic
928817587 2:35318230-35318252 TTTTGTTTTTATTGCATTTGTGG + Intergenic
928968880 2:37005759-37005781 GTTTTTATTTTGTGCATTTCAGG - Exonic
929165077 2:38874049-38874071 GTATGTGGGTTTTGCATTCCAGG + Intronic
929442667 2:41977535-41977557 GGTTGGGTTTTTTGTATTTTGGG + Intergenic
929488197 2:42373485-42373507 TTTTGTATTTTTTGGATTACAGG + Intronic
929661072 2:43785425-43785447 ATTTGTGTTTTTTTTGTTTCTGG - Intronic
929849511 2:45571232-45571254 GTTTGGGTTTTTTTCTTTTAGGG + Intronic
929972829 2:46598289-46598311 TTTTTTGTTGTTTTCATTTCTGG + Intronic
930691032 2:54364921-54364943 GTTTGTGTTCTCTCCATTTCTGG - Intronic
930705601 2:54502070-54502092 GTATGTGTATTTTTCTTTTCAGG + Intronic
931559307 2:63540974-63540996 GTTTTTGTTTTTTTGTTTTCTGG + Intronic
931651312 2:64471374-64471396 CTTTGTTTTTTGTTCATTTCAGG + Intergenic
931788168 2:65640038-65640060 GTTTGAGTTTTTTGGCTTTTAGG - Intergenic
931794438 2:65695881-65695903 GTTTGTGGTTTTTCCAGGTCTGG - Intergenic
932721764 2:74143857-74143879 TTTTTTTTTTTTTGTATTTCTGG + Intronic
932782979 2:74574258-74574280 GCTTTTATTTTTTCCATTTCAGG + Intronic
932789620 2:74643218-74643240 ATTTGTGTTTTTTTCAGTTTTGG - Intronic
932828340 2:74962011-74962033 GTTTGTGTTTTGAGCTTTTCTGG + Intronic
933313190 2:80685967-80685989 GGTTGTTGTTTTGGCATTTCTGG - Intergenic
933428442 2:82143557-82143579 GCATGTGTTTTTATCATTTCTGG - Intergenic
933438556 2:82280770-82280792 GATTATGTTTTTTCCATTTAAGG - Intergenic
933620585 2:84535674-84535696 TTTTTTTTTTTTTGCTTTTCTGG - Intronic
934158836 2:89229030-89229052 GTGTGTGTGTTTTGGATTGCGGG - Intergenic
934922313 2:98355125-98355147 GTAAGTCTATTTTGCATTTCTGG + Intronic
935175390 2:100644264-100644286 GTTAGTGGTTTTTGCATCTGTGG + Intergenic
935518325 2:104073082-104073104 GTTTCTGTCTGTTGTATTTCTGG - Intergenic
935858962 2:107306334-107306356 GTTTGTGTTTTTTTCCTTTATGG - Intergenic
936097808 2:109546605-109546627 GTTGTTGTTTTTTTCCTTTCTGG - Intronic
936625085 2:114140327-114140349 GTTTACTTTTTTTGCAGTTCTGG + Intergenic
936778673 2:116005129-116005151 GTTTGTTTTTTTGGCAGTTTGGG + Intergenic
937138787 2:119579805-119579827 GTTTTTGTTTGTTTCAATTCAGG + Intronic
937394176 2:121520262-121520284 CTTTGAGTTTTTTGCTTTGCAGG - Intronic
938042612 2:128088194-128088216 ATTTGGGTTTTTTCCAGTTCTGG - Intergenic
938605951 2:132893016-132893038 GTCTGTGCTTTTTTCCTTTCTGG - Intronic
939208285 2:139136956-139136978 ACTTGGGTTTTTTGCATTTCTGG + Intergenic
939331219 2:140763754-140763776 GTTTATGATATTTGTATTTCAGG + Intronic
939347529 2:140985982-140986004 GTTTTTATTTTTTTAATTTCTGG + Intronic
939425240 2:142027216-142027238 GTTTTTGTTTTTTTAATTTGGGG - Intronic
939590222 2:144055300-144055322 GTGTGTGTGTGTTCCATTTCAGG - Intronic
939659045 2:144864850-144864872 ATTTGTGTTGTTTCCATTTTTGG - Intergenic
939790262 2:146564204-146564226 TTTTTTTTTTTTTGCAGTTCAGG + Intergenic
939951686 2:148483088-148483110 GTTTTTTTTTTTTTCATTTTAGG + Exonic
940039365 2:149343918-149343940 GTTTTTGTTTTTTGAGTTGCAGG + Intronic
940930597 2:159424949-159424971 ATCTGTGTTTTCTGCATTTGCGG - Intronic
940984193 2:160036558-160036580 CTCTGTGTTATTTGCATTTCTGG + Intronic
941069698 2:160942135-160942157 TTTTTTTTTTTTTACATTTCTGG + Intergenic
941173970 2:162174440-162174462 GTTTTTGTTTCTTTGATTTCTGG + Intronic
941440076 2:165523701-165523723 GTTTGTGGTTTGTGACTTTCTGG - Intronic
941669286 2:168273867-168273889 GTTTTTTTTTTTTGCCTATCAGG - Intergenic
942678127 2:178450406-178450428 TTTTGTGGTTTTTGCAGTTTGGG - Exonic
943013648 2:182483514-182483536 GTTTGTTTTTTATGTATTTGTGG - Intronic
943018428 2:182543558-182543580 GATTTTGTTTTTTACATTTTGGG + Intergenic
943482392 2:188436230-188436252 GTTTGTTTGTTTTGCTATTCTGG + Intronic
943728233 2:191274114-191274136 GTTTATCTTTTTAGCATTTAGGG - Intronic
943910102 2:193553314-193553336 ATTTGTGTTGTTTCCATTTTTGG - Intergenic
944968792 2:204967631-204967653 GTTTGAGTACTTTGCATTTCTGG + Intronic
945329515 2:208523523-208523545 GTCTGTGTCTTTTACATTTAAGG + Intronic
945472372 2:210241752-210241774 GGTTATGTCTTTTGCATTTCAGG - Intergenic
945618183 2:212099736-212099758 GTTTTTTTTTTTTTCTTTTCAGG + Intronic
945681051 2:212915059-212915081 GTTTCTCTTTTTAGCTTTTCTGG + Intergenic
946471713 2:219966796-219966818 TTTTCAGGTTTTTGCATTTCTGG + Intergenic
946606795 2:221413864-221413886 GTTTGGCTTTTTTACATTGCTGG - Intergenic
946827641 2:223695268-223695290 GTTTTTGTTTTTTGTTTTTTTGG + Intergenic
947575973 2:231274451-231274473 ATTTGAGTTGTTTGCATTTTTGG + Intronic
947609961 2:231518647-231518669 ATTTCTTTTATTTGCATTTCAGG - Intergenic
947758174 2:232584228-232584250 GTGTGGGTTTTTTGCTTTTTTGG - Intergenic
947858415 2:233340440-233340462 GTTTGTGTTTTCTAGCTTTCTGG + Exonic
947991668 2:234492988-234493010 GTTTGTTTTTTTGACATTGCTGG - Intergenic
947998410 2:234547688-234547710 GTCTGTGTTTTCAGCATTTTGGG - Intergenic
948099469 2:235362024-235362046 TTTTTTATTTTTTGCATTTATGG - Intergenic
948350310 2:237334504-237334526 GTTGTTGTTTTTTGAATTTGTGG + Intronic
1168850938 20:976567-976589 GTATTTTTTTTTTCCATTTCAGG + Intronic
1168853092 20:989884-989906 AGTTCTGTTTTTTGCAGTTCTGG - Intronic
1169047731 20:2549057-2549079 ATTTGTGTTTTTTGGTTTTTTGG + Intronic
1169455855 20:5751797-5751819 GTTTGTTTTTTTTACATTTTAGG + Intronic
1169621853 20:7515768-7515790 CTTTGTGATTTCTGCTTTTCTGG - Intergenic
1170061898 20:12267826-12267848 GATTGTGTTTTATTTATTTCTGG + Intergenic
1170063163 20:12281822-12281844 TTTTGTGTTTTTTGGATTTTTGG - Intergenic
1170467429 20:16635615-16635637 GTTTGTGTTTTTTGTAGATGGGG + Intergenic
1170755420 20:19200850-19200872 GTGTGTGTCTTTTGTTTTTCTGG + Intergenic
1170857778 20:20073288-20073310 ATTTGTGTTGTTTGCCTTTTGGG + Intronic
1170874961 20:20242065-20242087 AGTTGAGTTTATTGCATTTCTGG + Intronic
1171021399 20:21587287-21587309 CTTTGTGCTTTCTGCATTTCTGG + Intergenic
1171187403 20:23132776-23132798 CTTTCTGTTTTCTGAATTTCTGG + Intergenic
1171749426 20:29034129-29034151 GTTTTTTTTTTTTCCATGTCAGG + Intergenic
1172180193 20:32998471-32998493 GTTTTTGTTTTTTGGTTTTTGGG - Intronic
1174430794 20:50467230-50467252 TTTTTTGTTTTTTGCTTTTGAGG - Intergenic
1174777810 20:53361916-53361938 TTTTGTGTTTTTTTTTTTTCTGG + Intronic
1175315244 20:58042806-58042828 GTTTGTCTTTTTCACAGTTCTGG - Intergenic
1175428632 20:58888181-58888203 GTTTGTGGACTTTGCATATCTGG + Intronic
1176951535 21:15052713-15052735 CATTGTGTTTTTTGGAATTCTGG - Intronic
1177320142 21:19510558-19510580 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1177395901 21:20536071-20536093 TTTTTTGTTTTTTGTTTTTCTGG + Intergenic
1177438653 21:21089101-21089123 GTTTTTGTTTTTAGCAAATCTGG + Intronic
1178308851 21:31512803-31512825 GTTTGTTTGTTTTGTATTTTTGG + Intronic
1178573071 21:33758806-33758828 GTTTGTGTGCTTGGGATTTCTGG + Intronic
1178955800 21:37020574-37020596 TTTTGTGTGTTTTTCTTTTCTGG + Intergenic
1179176955 21:39014933-39014955 TTTTGTGGTTTTTGCTTTTCTGG + Intergenic
1179889517 21:44328523-44328545 GTTGGCGTTTCTGGCATTTCGGG + Intergenic
1180925541 22:19551509-19551531 ATTTGTGTTGTTTCCATTTTTGG + Intergenic
1182131288 22:27854238-27854260 TTTTTTTTTTTTTGCATCTCTGG + Intronic
1182971407 22:34581663-34581685 GTTTTTGTTTTTTGTTTTTTAGG + Intergenic
1184741266 22:46430303-46430325 GGTTTTGGTTTTTGCATTTTTGG - Intronic
1184824999 22:46943962-46943984 ATTTGGGTTGTTTGCACTTCTGG + Intronic
949095234 3:77753-77775 GTTTGTTTGTTTTGGTTTTCTGG + Intergenic
949390526 3:3557386-3557408 GTTTTTGGTTTTTACATATCTGG - Intergenic
949390755 3:3559544-3559566 GTTTATGTTTATTCCAATTCAGG + Intergenic
950989882 3:17422145-17422167 GTTTTTGTTTTTTGGTTTTTGGG + Intronic
951162225 3:19438435-19438457 GTTTATCTGTTTTGTATTTCAGG - Intronic
951407617 3:22320032-22320054 GTATGTGTTTTGTGAAATTCAGG - Intronic
951422561 3:22504580-22504602 GGTTGTGTTGTTTAAATTTCTGG - Intergenic
951763813 3:26174335-26174357 GTTTGAGTTTGTTGTAATTCTGG + Intergenic
951859721 3:27238354-27238376 CTGTGAGTTTTTTCCATTTCTGG + Intronic
951995419 3:28722441-28722463 GTGTGTGTTTTTTACATAACTGG + Intergenic
952083014 3:29783174-29783196 CTTTGAGTTTCTTGCATTTGGGG - Intronic
952200752 3:31124988-31125010 GGTTATGTTTTTTTCCTTTCAGG + Intergenic
952209509 3:31215319-31215341 TTTTTTCTTTTTTCCATTTCTGG - Intergenic
952599707 3:35065513-35065535 GATTGTGTTTTTTCCATTACAGG - Intergenic
952690648 3:36201152-36201174 GTTTGTTTGTTTAGCATTTTTGG + Intergenic
952809134 3:37385749-37385771 GTTTTTGTTTTTTTTACTTCTGG - Intergenic
953118627 3:40017027-40017049 ATTTCTGTCTTTTGGATTTCTGG + Intronic
953734893 3:45484860-45484882 CTTTGTATTCTTTGAATTTCTGG + Intronic
955094597 3:55784858-55784880 GTTTGTTTTGTTGGCATTTGTGG - Intronic
955207604 3:56910638-56910660 GTTTCTGTTTTTGGCTTTTTAGG - Intronic
955631947 3:60983946-60983968 GTTTTTGTCTTTATCATTTCAGG - Intronic
955944859 3:64183496-64183518 GTTTTTGCTTTATGCATTTGAGG - Intronic
956307148 3:67837860-67837882 GTTGGGGATTGTTGCATTTCCGG + Intergenic
956397117 3:68837840-68837862 GTTTGTGTTTTTTTTAGTTCAGG + Intronic
956596089 3:70969123-70969145 TTTTTTTTTTTTTGCCTTTCCGG + Intronic
956656564 3:71558476-71558498 GTTTTTGTTTTTTGTTTTTTTGG + Intronic
956929960 3:74032131-74032153 GTTTGAGTTTTGTTCTTTTCAGG + Intergenic
956935280 3:74093960-74093982 GTTTGTTTTTTCTGTATCTCAGG + Intergenic
957356377 3:79093117-79093139 GCTTCTGTTTTTTGCCTTTTTGG + Intronic
957501249 3:81059785-81059807 TTTTCTGGTTCTTGCATTTCTGG - Intergenic
957946078 3:87064742-87064764 CTTTGTGTTTTATGTATTTTTGG - Intergenic
957963483 3:87291384-87291406 TTTTGTGTGTTTTGCATTCCAGG - Intergenic
958101768 3:89020470-89020492 GTTTTTGTTTTTTGTTTTTTGGG + Intergenic
958565993 3:95810986-95811008 TTTTGTATTTTTTGTATATCTGG - Intergenic
958580202 3:96008182-96008204 GTTTGGGTTGTTTGGATGTCTGG - Intergenic
958679635 3:97311080-97311102 GTTAGTGTTTTTTGCAAGTCTGG + Intronic
959092450 3:101918299-101918321 GTTTGTTTGTTTTCCATTTCCGG - Intergenic
959321371 3:104879454-104879476 GTGTGTGTGTTTTTCTTTTCGGG - Intergenic
959637037 3:108587254-108587276 ATTTGGGTTGTTTACATTTCTGG - Intronic
959974928 3:112448178-112448200 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
960014000 3:112865315-112865337 CTTTCTGTTTTTTAAATTTCGGG + Intergenic
960027074 3:113021455-113021477 GTCTGTGTTTCTTCCATTTCAGG + Intergenic
960129338 3:114037917-114037939 TTTTGTGGGTTCTGCATTTCTGG - Intronic
960420669 3:117441542-117441564 GTGTTTGGTTTTTGCATTTTAGG - Intergenic
960497595 3:118394492-118394514 GTTTTTGTTTTTTGCATCATTGG + Intergenic
960733846 3:120756317-120756339 GTTTGTGTTTTTAGCACTTCAGG - Intronic
960922625 3:122762981-122763003 ATTTGTGTTTTTCTCATTTTAGG + Intronic
961254105 3:125532014-125532036 ATGTGTGGTTTTTGGATTTCAGG - Exonic
962438765 3:135392463-135392485 GTGTGTATTTTCTGCATGTCAGG + Intergenic
963124010 3:141798434-141798456 GTATGTGTTTTATCCTTTTCTGG - Intronic
963658033 3:148084398-148084420 GTATGTGTTTTTTGAGTTTTTGG + Intergenic
963774602 3:149425802-149425824 TTTTTTTTTTTTTGCATTTTAGG - Intergenic
963791203 3:149584345-149584367 GGTTTTGTTTTTTTCAATTCTGG + Intronic
963829219 3:149989247-149989269 TTTTGTGTATTTTGTATTTTAGG + Intronic
963928876 3:150981110-150981132 ATTTGGGTTGTTTGCATTTTGGG - Intergenic
964019498 3:151991759-151991781 ATTTTTATTTGTTGCATTTCAGG - Intergenic
964045644 3:152322348-152322370 GTTTGTGTTTTTTTAATCTTGGG - Intronic
964519952 3:157554324-157554346 GTTTGTGTTTTTTCCACTCAGGG + Intronic
964781375 3:160341999-160342021 GCTTGTGTTTTTCTCACTTCTGG + Intronic
965108649 3:164391270-164391292 GTTTGTTTGTTTTGCTTTTTAGG + Intergenic
965582292 3:170281986-170282008 GTTTGTGTTGTTTTCTTTTTGGG + Intronic
965594044 3:170389680-170389702 GTATGAGTTTTTTAAATTTCTGG + Intronic
966991723 3:185238815-185238837 TTTTGTTTTTGTTGCATTTGAGG + Intronic
967064710 3:185904619-185904641 TTTTGTGTTTTTTGCAGACCTGG + Intergenic
967122504 3:186395541-186395563 GTTTTTGTTTTTTGTTTTTTCGG - Intergenic
968252060 3:197227484-197227506 GTTTTTGTTTTTTGTTTTTTTGG - Intronic
968403478 4:318306-318328 GTTTTTGATTTCTCCATTTCAGG + Intergenic
968919053 4:3513178-3513200 TTTTGTGATTTGAGCATTTCTGG - Intronic
969332651 4:6488295-6488317 CTTTGTGATTTTTGCCTTTTAGG + Intronic
969568747 4:7995750-7995772 GTTTGCCTGTTTTGCATATCGGG - Intronic
969923607 4:10563994-10564016 ATTTGTATTTTATGCCTTTCTGG + Intronic
970013157 4:11482755-11482777 ATTTGTGTTGTTTGCATTGGAGG + Intergenic
970180088 4:13383016-13383038 TTTTGTTTTTTTTGCTCTTCTGG + Intronic
970645260 4:18113198-18113220 GTTTATTTATTTTGCCTTTCCGG + Intergenic
970765474 4:19543654-19543676 GTTTGTGTGTTTTTTTTTTCTGG - Intergenic
970907474 4:21233134-21233156 TTCTCTGTTCTTTGCATTTCAGG - Intronic
971254121 4:24998455-24998477 GCTTTTGTTTTCTGCATGTCTGG - Intergenic
971370258 4:26013364-26013386 ATATGTGTTTTTTGAATTTAAGG + Intergenic
971700639 4:29970007-29970029 ACTTGCGTGTTTTGCATTTCAGG - Intergenic
971801301 4:31295201-31295223 GTTTGGTTTTCTGGCATTTCTGG - Intergenic
971822271 4:31573112-31573134 ATTTGCATTTCTTGCATTTCTGG + Intergenic
971829452 4:31671734-31671756 TTTTGTGTTTGTTGTATTTTTGG - Intergenic
972000946 4:34031783-34031805 GTTTATATTTCTTGCATCTCTGG - Intergenic
972439714 4:39075943-39075965 GTGTGTTTTTTTTTCTTTTCAGG + Exonic
972611456 4:40659370-40659392 GTTTGTGTTTTTTCCCTCTGAGG - Intergenic
973218836 4:47702714-47702736 GTATGTTTTTTTTCTATTTCTGG - Intronic
973622461 4:52741394-52741416 GTGTGTGTTTTGTGCTTTTTGGG + Intronic
973737165 4:53883573-53883595 GTTTTTGTTTTTTGTTTTGCTGG + Intronic
973822856 4:54678013-54678035 GTTTTTGTTTTTTACATTTGAGG + Intronic
974014724 4:56638673-56638695 TTTTTTTTTTTTTGCATTTTTGG + Intergenic
974304333 4:60112855-60112877 TTTTTTGTTCTTTTCATTTCTGG - Intergenic
974712530 4:65618677-65618699 GTTTGTGTTTTTCTTATATCTGG + Intronic
974714968 4:65656947-65656969 GTGTGTGTTTTTTTTTTTTCTGG + Intronic
974856968 4:67473091-67473113 GTTTTTGTTTTTTCTTTTTCTGG + Intronic
974884756 4:67805023-67805045 TGTTGTGTTTTTTTCATTTCTGG + Intergenic
975087117 4:70355455-70355477 GTATCTGTTTTGTGCCTTTCTGG - Intergenic
975701535 4:77071763-77071785 GTTTTGGTATTTTGTATTTCTGG - Intronic
975759896 4:77609278-77609300 GTTTCTGTTTTTTGTGTTTTGGG + Intronic
975775478 4:77782008-77782030 TTTTGTGTTTTTTCAATTTTAGG - Intronic
976078303 4:81324185-81324207 GTTTTTGTTTTTATCATTTTGGG - Intergenic
976386290 4:84462832-84462854 GTTTGTTTTTTTGGTATTTTTGG + Intergenic
976397809 4:84575471-84575493 ATTTGTGATTTTTGCACTTTTGG - Intergenic
977891910 4:102322003-102322025 GTCTGTGGTTTTTGCCTTCCTGG + Intronic
978487089 4:109267424-109267446 GTTTTTCTTTTTTAGATTTCTGG - Intronic
978542184 4:109829813-109829835 GTGTGTGTTGTTTGTGTTTCTGG + Intronic
978708895 4:111752745-111752767 ATTTTTGTTTTATGTATTTCGGG - Intergenic
979293804 4:119007379-119007401 GTTTTTGTTTTTAACATTTCAGG - Intronic
979437390 4:120710196-120710218 GTGTGTGTGTGTTGCATTGCTGG - Intronic
979911843 4:126377326-126377348 TTTTATGTTTTATGCATTCCTGG + Intergenic
979931077 4:126631574-126631596 GTCTGTGTTTTTTGCATTTGTGG - Intergenic
980329474 4:131391309-131391331 TATTGTGATTTTTGCCTTTCAGG + Intergenic
980476073 4:133318732-133318754 GTTTTTGTTTTTTGTTTTTTGGG + Intergenic
980483146 4:133415820-133415842 GTTTGTATTCTATTCATTTCAGG + Intergenic
980558797 4:134443404-134443426 GTTTGTGCTTTTTGCATCCTAGG + Intergenic
980581410 4:134758361-134758383 GTTTATGTTTTTGGAATTACAGG + Intergenic
980615040 4:135208662-135208684 GTTTCTGCTTTTTGCAACTCTGG - Intergenic
980718893 4:136666960-136666982 GTTTGTGATTTTTGCTTTGTTGG - Intergenic
981258486 4:142691573-142691595 GTTTGTGTTTTTTCTAAATCTGG - Intronic
981290082 4:143064701-143064723 ATTTGGGTTATTTTCATTTCAGG + Intergenic
981537565 4:145815612-145815634 CTTTGTGTTTATTTCTTTTCAGG - Intronic
981882806 4:149635728-149635750 GTTTCAGTTTTTTGCTTTTCTGG - Intergenic
982110889 4:152052579-152052601 GTTTCTGTTTTTAGCACTTGTGG + Intergenic
982689486 4:158531939-158531961 GTTTGTTTGTTTTACATTTAGGG + Intronic
982999601 4:162397515-162397537 GTTTGTTTTTATTGCATTTTGGG - Intergenic
983284637 4:165724087-165724109 TTTTGTGTTCTATCCATTTCTGG + Intergenic
983439272 4:167760718-167760740 ATTTGTTTTTTATGTATTTCTGG + Intergenic
983632716 4:169865733-169865755 GTTTGTCATTTTTTCATGTCTGG + Intergenic
984035206 4:174659128-174659150 TTTTGTGTTTTCAGCACTTCTGG - Exonic
984348148 4:178558111-178558133 GTTTTTGTTTTTTGGTTTTAAGG - Intergenic
984420762 4:179518025-179518047 GTTTGTGTTATTTGTTTTTTAGG + Intergenic
984461616 4:180044210-180044232 GTTTGTATTTTTTTCATATGTGG + Intergenic
984519943 4:180789192-180789214 ATTTATGTTTTTTGCCCTTCAGG - Intergenic
984617892 4:181919229-181919251 GTGTGTGTCTTTGGCATCTCAGG + Intergenic
985102485 4:186472359-186472381 GTTTGTTTTTTTTGTTTTTTTGG + Intronic
985176040 4:187202179-187202201 CTTTCTGTTTTTATCATTTCTGG + Intergenic
986186759 5:5449458-5449480 GTTTTTGTTTTTTTTTTTTCCGG - Intronic
986488292 5:8262954-8262976 ATTTGTGTTTTCTGGGTTTCAGG + Intergenic
987028155 5:13949016-13949038 GTGTGTGTTTTTTTTCTTTCTGG - Intergenic
987035045 5:14011365-14011387 CTTAGTGCGTTTTGCATTTCGGG + Intergenic
987247508 5:16063419-16063441 GTGTGTGTGTTTTGTATTTTTGG - Intergenic
987350728 5:17019589-17019611 GTTTTTGTTTTTTGCTCTTTTGG - Intergenic
987419592 5:17703397-17703419 ATTTGCATTTTTTTCATTTCCGG + Intergenic
987607896 5:20162119-20162141 CTTTGTTTTTTATGTATTTCTGG - Intronic
987678541 5:21107145-21107167 TTCTGTGATTTTTGGATTTCAGG + Intergenic
987720805 5:21629732-21629754 TTTTGTGTTTTTTGTAATTATGG + Intergenic
987740735 5:21905635-21905657 GTCTGTGTTTTTTGTTTTCCTGG + Intronic
987915641 5:24209527-24209549 GTTTGTTTGTTTTCCATTTGGGG + Intergenic
989122929 5:38022174-38022196 TATTGTGTTTTTTGAATTTTGGG - Intergenic
989300872 5:39891922-39891944 GTTTGTTTTTATTGTATTTCTGG + Intergenic
989343465 5:40403379-40403401 GTTTTTGTTTTTTAATTTTCTGG + Intergenic
990251782 5:53923212-53923234 GTTTGTTTGTTTTGAGTTTCAGG - Intronic
990289392 5:54333302-54333324 GTTTTTTTTTTTTTAATTTCAGG - Intergenic
990590794 5:57261665-57261687 GTTTTTGTTTTTGGCTTTTCTGG + Intronic
990780564 5:59357176-59357198 GTGTGTGTGTTGTGCTTTTCAGG - Intronic
990820930 5:59839417-59839439 TTTTTTGTTTTTTGTTTTTCAGG + Intronic
993248189 5:85479578-85479600 ATGTGTGGTTTTTGCATTTAAGG - Intergenic
993419210 5:87679562-87679584 GTTTGTGTTGTTTCCAGTTTGGG - Intergenic
993439628 5:87939695-87939717 GTTTCTGCTTTTCACATTTCAGG - Intergenic
993682239 5:90894111-90894133 GTTTTTATTGTTTGCATTTGGGG - Intronic
994205864 5:97034649-97034671 GTTTTGGTTTTTTGCTTTTGAGG + Exonic
994558477 5:101334762-101334784 GTTTTTGTTTTTTCAATTTTAGG - Intergenic
994813890 5:104558305-104558327 GTATGTTCTCTTTGCATTTCTGG + Intergenic
996621190 5:125505802-125505824 GTTTGTGTGTTTAGCATTAATGG + Intergenic
996622254 5:125521393-125521415 GTTTTTGTTTTTTGCATACCTGG + Intergenic
996709757 5:126532622-126532644 TTTTTTTTTTTTTTCATTTCAGG + Intergenic
997486909 5:134238880-134238902 GTTTTTGTTTTTTTAATGTCAGG + Intergenic
998239811 5:140430175-140430197 GTTTTTGTCTTTAGTATTTCAGG + Intronic
998596140 5:143532502-143532524 GTTTGGATTTTTTGCATTAATGG - Intergenic
998830779 5:146156211-146156233 TTTTGCGTTTTTTGAATTTTGGG + Intronic
999163625 5:149527985-149528007 ATTTGTGCCTTTTACATTTCAGG - Intronic
999259879 5:150231604-150231626 TTTTTTTTTTTTTGCCTTTCTGG - Intronic
999444771 5:151630614-151630636 GTTTTTGTTTTTTGTTTTTTTGG + Intergenic
999448790 5:151663175-151663197 CTTTGTGTTCATTTCATTTCAGG - Exonic
999902827 5:156104857-156104879 GTTAGTATTTTTTTCAGTTCTGG + Intronic
1000436353 5:161214702-161214724 AATTGTGATTTTTGCATTGCTGG - Intergenic
1000556161 5:162728834-162728856 ATTTGTGTTGTTTGCATATTGGG - Intergenic
1000918153 5:167106912-167106934 CTTTTTGTTTGTTGCATTTTTGG - Intergenic
1000942476 5:167378922-167378944 TTTTTTGTTTTTTCCCTTTCTGG - Intronic
1000979569 5:167802075-167802097 GTTTGTTCCTTTTGCACTTCAGG - Intronic
1001386312 5:171342361-171342383 ATTTGTCTTATTTGCATTTCAGG + Intergenic
1001616186 5:173045373-173045395 CTTTGTGTTTTTTTTTTTTCCGG + Intergenic
1002565063 5:180108033-180108055 GTTTATGTTTTTTCCAACTCTGG + Intronic
1004420342 6:15464040-15464062 CTTTGTGTCTTATGCATTTGAGG + Intronic
1004950762 6:20668723-20668745 TTTTGTCTTTTTTCCAGTTCAGG + Intronic
1005689178 6:28285401-28285423 GTTTGTTGTTTTTGTTTTTCTGG + Intronic
1006801090 6:36760043-36760065 TTTTTTTTTTTTTGCATTTTTGG - Intronic
1007184378 6:39955797-39955819 GTTTGTCTTTTTTTAACTTCAGG - Intergenic
1007586942 6:42996496-42996518 GTTTGTTTTTTTTTCTTTTTTGG - Intronic
1007771977 6:44199611-44199633 ATCTGTGTTTTTTGTCTTTCTGG - Intergenic
1008145937 6:47891442-47891464 GTTTGTGTTTTTTTCAGATTTGG - Intronic
1008510749 6:52273551-52273573 GTGTGTCTTTTGTCCATTTCTGG - Intronic
1008922262 6:56854770-56854792 GTCAGTGTTTTTAACATTTCTGG + Intronic
1009675639 6:66816148-66816170 ATTTGGGTTCTTTGCATTTTGGG - Intergenic
1010160478 6:72848006-72848028 GTTTTTTTTTTTAGCTTTTCTGG - Intronic
1010856015 6:80840898-80840920 TTTTTTGTTTTTTGTATTTCTGG - Intergenic
1011148956 6:84247598-84247620 GTATGTGTGTTTTGACTTTCTGG - Intergenic
1011276847 6:85640684-85640706 GTGTGTGTTTTTTTTTTTTCAGG - Intronic
1011599240 6:89044616-89044638 GTTTGTGTTTTTTTTTGTTCAGG - Intergenic
1011973231 6:93255671-93255693 TTTTTTGTTTTTTGTTTTTCTGG - Intronic
1011989159 6:93490836-93490858 TTTTGTTTTTTTTGTTTTTCAGG - Intergenic
1012515145 6:100050656-100050678 GTTTGACTTTTGTGCATTTTTGG + Intergenic
1012816214 6:104025805-104025827 GTTTGATTTTTGTGCATTTTTGG + Intergenic
1012925638 6:105264252-105264274 GTTTTTGTTTGTTGCCTTTTAGG - Intergenic
1013802194 6:113960018-113960040 GTTTGTGTCTTTTCTATTTTAGG - Exonic
1014029300 6:116682101-116682123 TTTTGTATTTTTTGTATTTTTGG - Intronic
1014160261 6:118159444-118159466 GTATGAGTTGTTTGGATTTCAGG - Intronic
1014238678 6:118990702-118990724 TTTTGTATTTTTTGTATTTTTGG - Intronic
1014975935 6:127884171-127884193 GTTTGTTTGTTTTGCTTTACAGG + Intronic
1015056817 6:128912407-128912429 GGTTTTATTTTTTACATTTCTGG + Intronic
1015116777 6:129658413-129658435 GTTTTTTTTTTTTCCATTTGAGG - Intronic
1015387618 6:132642678-132642700 GTTTTTGTCTTTTGATTTTCCGG - Intergenic
1015784622 6:136909301-136909323 GTTTGTTTGTTTTTAATTTCAGG - Intronic
1016182712 6:141167464-141167486 GTATGTATTTTTTTCAATTCAGG - Intergenic
1016732518 6:147442088-147442110 GTTTTTATTTTTGGCATTTTAGG + Intergenic
1017169295 6:151441056-151441078 GTTTGGGGTTTTTGCTTTTTGGG - Intronic
1017267924 6:152472731-152472753 TTTAGTATTTTTTGCCTTTCTGG + Intronic
1018548852 6:164969413-164969435 TTTTGTATTTTTTGCTTTTTTGG - Intergenic
1018985999 6:168637797-168637819 GTTTGTGCTGCTTGCAATTCAGG + Intronic
1019175938 6:170159578-170159600 GTTTCTGCTGTTTGCATGTCAGG + Intergenic
1019451725 7:1102152-1102174 TTTTGTGTGTTTTTCTTTTCTGG - Intronic
1019872043 7:3773695-3773717 GTTTTTGTTTTTTGTTTTGCTGG + Intronic
1020345553 7:7159041-7159063 GTTTGTGACTTATGCATTTTTGG + Intronic
1020408125 7:7860337-7860359 GTTTGTGTTTCTCTCACTTCGGG + Intronic
1020742165 7:12034832-12034854 TTTTTAGTTTTTGGCATTTCTGG - Intergenic
1020776081 7:12455607-12455629 TTTTTTGTTTTTTGTTTTTCTGG + Intergenic
1020864431 7:13539584-13539606 GTTTGTGTTTTGGCAATTTCTGG - Intergenic
1020866725 7:13573752-13573774 GATTGTATTTTTTTCATTTGGGG + Intergenic
1020936424 7:14471598-14471620 TTTTGTTTGTTTTGCATTGCTGG + Intronic
1021074796 7:16288871-16288893 GTTTTTGTTTTTTGTTTTTGGGG - Intronic
1021108565 7:16667774-16667796 TTTTCTATTTTTTTCATTTCTGG + Intronic
1021285277 7:18773309-18773331 ATTTGTGTTTTTTACATTACTGG + Intronic
1021317254 7:19164086-19164108 GTTTATGCTTTTTGAATTCCAGG + Intergenic
1021547805 7:21834856-21834878 GTTTGTGTTATTTGTTTTTTTGG - Intronic
1021570868 7:22063788-22063810 GTGTGTATTTTGTGCATATCAGG + Intergenic
1021953630 7:25801037-25801059 GTTTGTGTTTTTTGTGTTTAAGG - Intergenic
1021960641 7:25869532-25869554 GTTTGTTTTTATGGCATTTTAGG - Intergenic
1022963138 7:35449249-35449271 GTTAGTGTTTTCTGACTTTCTGG - Intergenic
1022991443 7:35712175-35712197 CTTTTTGTTTTTTGTATTTTAGG - Intergenic
1023105108 7:36756185-36756207 GTTTTTTTTTTCTGAATTTCTGG - Intergenic
1024595448 7:50931094-50931116 GTTAGTGCTTTTAGCAATTCCGG + Intergenic
1024807906 7:53168450-53168472 GTTTGTTTGTTTTTCTTTTCAGG - Intergenic
1025186455 7:56863720-56863742 TTTTTTGTTTTTTGTATTTTTGG - Intergenic
1025685467 7:63713175-63713197 TTTTTTGTTTTTTGTATTTTTGG + Intergenic
1025778597 7:64579589-64579611 GTTTGGGTTTTTTGTCTTTGGGG - Intergenic
1025809053 7:64862587-64862609 GTTTGTTTTTTGTGCATGTGGGG + Intergenic
1025877327 7:65495071-65495093 GTTTGTGCTCTTTTAATTTCGGG + Intergenic
1026138604 7:67685511-67685533 GCTTGTGATTTTTGCCTTTTGGG + Intergenic
1026216077 7:68350268-68350290 ACTTCTGTATTTTGCATTTCAGG - Intergenic
1026615723 7:71901878-71901900 TTTTGTTTTTGTTGCATTTGAGG - Intronic
1026860754 7:73786635-73786657 TTTTTTTTTTTTTGCATTTGAGG + Intergenic
1026914966 7:74114575-74114597 GTCTATGTTTTTTGCTTTTCGGG - Intronic
1027208959 7:76128302-76128324 TTTTGTTTTTTGTGCATTTGTGG - Intergenic
1027530127 7:79320216-79320238 GTGTGTGTTATTTGTATATCAGG - Intronic
1027533814 7:79369735-79369757 ATGTGTGTTTATTGCTTTTCAGG + Intronic
1027824263 7:83090328-83090350 CTTTCTGTTTCTTGGATTTCTGG - Intronic
1027890929 7:83973904-83973926 GTTTTTTTTTTTTTCCTTTCTGG + Intronic
1028641004 7:93041781-93041803 GTTTTTGTTTTTTGCCTCTGTGG - Intergenic
1030027643 7:105340587-105340609 GTTTTTGTTTTTTGGTTTTGAGG + Intronic
1030437284 7:109539186-109539208 GTTTTTGTTTTTTGGTTTTTTGG + Intergenic
1030868320 7:114726877-114726899 TTTTTTTTTTTTTGCATTTTTGG + Intergenic
1031091141 7:117356419-117356441 GTTTATGGATTTTTCATTTCCGG - Intergenic
1031257687 7:119477289-119477311 GTTTGTGTTTGTTAAATTTATGG - Intergenic
1031406976 7:121397168-121397190 GTTTGTGTGTTTTATATTTTTGG - Intergenic
1031559268 7:123218151-123218173 TTGTCTGTTTTTTTCATTTCAGG - Intergenic
1031615474 7:123874403-123874425 TTTTTTGTTTTTTGCTTTTGAGG + Intronic
1031644924 7:124213076-124213098 CTTTTTATTTTTTGCATTACTGG + Intergenic
1033729652 7:144164064-144164086 GTTTGGGATTTTTGTCTTTCAGG - Intergenic
1034592075 7:152149465-152149487 GTGTGTGTTTTTTCTTTTTCTGG - Intronic
1035027351 7:155834754-155834776 GTTTGTGTTTTCTCCACTTTTGG + Intergenic
1035765518 8:2101888-2101910 GTTTCTGTTTTTAGCACTTGCGG + Intronic
1035787530 8:2273477-2273499 TTTTTTTTTTTTTCCATTTCAGG - Intergenic
1035805278 8:2448239-2448261 TTTTTTTTTTTTTCCATTTCAGG + Intergenic
1035912984 8:3588849-3588871 GTTTGAGTTCTTTGTATTTGTGG - Intronic
1035924534 8:3713042-3713064 GTTTTTGTTTGTTGCTTTTGGGG - Intronic
1036058439 8:5287175-5287197 TTTTTTTTTTTTTACATTTCTGG - Intergenic
1036110409 8:5893781-5893803 GTTTGTCTTTTTTTGATATCAGG - Intergenic
1037190486 8:16118820-16118842 GTTTTTCTTTTTTGTTTTTCTGG - Intronic
1037492075 8:19406123-19406145 GTTTGTGCTTGTTGCAACTCAGG - Intronic
1037761854 8:21746787-21746809 CTTTTTTTTTTTTGCTTTTCTGG - Intronic
1037954767 8:23047069-23047091 GCTTTTGTTTTTTGCACTTTAGG - Intronic
1038341103 8:26685714-26685736 ATTTGTGTTGTTTCCATTTGGGG + Intergenic
1038354601 8:26816038-26816060 GTTTCTGTGTCTTGCCTTTCTGG - Intronic
1038624328 8:29176041-29176063 GTTTGTTTTTTTTCCCTTCCTGG - Intronic
1038960581 8:32514206-32514228 GTTTGTCTAATTTGCATTTTCGG - Intronic
1039084945 8:33770610-33770632 TTTTTTTTTTTTTACATTTCTGG - Intergenic
1039157512 8:34578313-34578335 GATTGTGTTTGGTGCATTTAAGG - Intergenic
1039160767 8:34616676-34616698 GTTTTTGTTTTTTGTATTTTTGG + Intergenic
1039578093 8:38641683-38641705 GTTTGTGTTATTTCCAGTTTGGG - Intergenic
1040483214 8:47845588-47845610 GTTTGTTTGTTTTTAATTTCTGG - Intronic
1040558190 8:48499621-48499643 TATTTTGTTTTTTACATTTCTGG + Intergenic
1040825616 8:51617885-51617907 GTTTGTGTGTTTTCCATTACAGG - Intronic
1040978110 8:53216277-53216299 CTTTTTTTTTTTTTCATTTCAGG + Intergenic
1041049267 8:53917077-53917099 ATTTGTGTTTTTTTCAGTTCTGG + Intronic
1041344342 8:56880553-56880575 GTTTGGGTTTTTTGCCATGCTGG - Intergenic
1041411993 8:57566234-57566256 TTTTGTATATTTTGCATATCTGG + Intergenic
1041891374 8:62873020-62873042 GTCTGTGTCTTTTACATTTAAGG - Intronic
1041923448 8:63209661-63209683 GTGTGTGTTTTTTTTTTTTCAGG + Exonic
1042292688 8:67185817-67185839 ATTTGACTTTTATGCATTTCTGG - Intronic
1042342683 8:67696594-67696616 ATTTGTGTTGTTTCCATTTTTGG - Intronic
1042583558 8:70309410-70309432 TTTTGTGTTTGTTGCCATTCTGG - Intronic
1043079382 8:75746510-75746532 TTTTTTGTCTTCTGCATTTCGGG + Intergenic
1043187401 8:77172006-77172028 ATTTGTGTTTCTTCCACTTCAGG - Intergenic
1043295428 8:78656237-78656259 GTTTGTGCTTTGTGCTTTCCAGG + Intergenic
1043658554 8:82705220-82705242 TTTTTTTTTTTTTGTATTTCTGG - Intergenic
1043686968 8:83099061-83099083 TTTTTTGTTTTTTGCTTTTTTGG + Intergenic
1043723122 8:83573095-83573117 GTTTGTGTGTTTTTCTTTTGGGG + Intergenic
1044049078 8:87477204-87477226 TTTCTTCTTTTTTGCATTTCAGG - Intronic
1044354503 8:91205009-91205031 GTTACTGTTTTTTGCCTTTCAGG + Intronic
1044388215 8:91615999-91616021 ATTTGTGTTTCTTGAATGTCTGG - Intergenic
1044555200 8:93555721-93555743 ATTTGTTTATTTTTCATTTCTGG - Intergenic
1044586800 8:93875982-93876004 GTTTTTGTTTTTTGTTTTTTTGG - Intronic
1044776658 8:95696098-95696120 GTTTGGGTTTTTTGTTTTTCAGG - Intergenic
1045471794 8:102519142-102519164 GTTTGTTTGTTTTTCATGTCTGG - Intergenic
1045514408 8:102844718-102844740 TTGTGTTATTTTTGCATTTCTGG - Intronic
1046017543 8:108623307-108623329 GTTTGTTTGTTTTGCTTATCTGG - Intronic
1046078584 8:109342165-109342187 TTTTTTTTTTTTTGCATTTATGG + Intronic
1046520039 8:115312433-115312455 GTTTGTGTTTTTCAGATTGCAGG - Intergenic
1046858138 8:119058675-119058697 GTTTGTATTTTTTCAATTTCTGG + Intronic
1046888461 8:119395292-119395314 GTTGGGGTTTTTAGCAGTTCAGG + Intergenic
1047088685 8:121548723-121548745 CTTTGTCTTTTTTGGAGTTCAGG + Intergenic
1047541597 8:125772067-125772089 ATTTGTGTTTATTATATTTCTGG + Intergenic
1047990642 8:130283048-130283070 GTTGCTGTTATTTGTATTTCAGG - Intronic
1049549012 8:143247782-143247804 GTTTTTGTTTTTTGCGTGTGGGG + Intronic
1050178203 9:2891520-2891542 GTTTGTGTTTATTCCAGTTAAGG - Intergenic
1050344297 9:4671098-4671120 TTTTGTGTTTCTTCCTTTTCAGG - Intergenic
1050719299 9:8567156-8567178 GTTTGTGTTTTTTGCATTTCTGG - Intronic
1050756783 9:9014195-9014217 GTTTGTTTTTTTTTTTTTTCTGG + Intronic
1051143321 9:14001642-14001664 AATTGTGTTTTTTGCATTGTTGG - Intergenic
1051784563 9:20728249-20728271 TTTTATGTTTTTTGGATTTTGGG + Intronic
1051883621 9:21865916-21865938 GTTTGAATTTTTTCCATTTGAGG + Exonic
1052053705 9:23880245-23880267 TTTTTTGTTTTTTGCTTTTGAGG + Intergenic
1053059210 9:35016220-35016242 ATATGTCTTTTTTGCACTTCAGG + Intergenic
1053156112 9:35780707-35780729 GTTTGTTTGTTTTGTATTTTTGG - Intergenic
1053235167 9:36446955-36446977 GTTTTTTTTTTTTGTATTTTTGG - Intronic
1055053542 9:72002933-72002955 ATTTGGGTTTTTTGCAGTTTAGG - Intergenic
1055062064 9:72079356-72079378 GGTTTTGTTTTTAGCATTTTGGG - Intergenic
1055103390 9:72487928-72487950 GTTTGGGATTGGTGCATTTCTGG + Intergenic
1055546500 9:77380000-77380022 GTTTTTGTTTTGTGTATTTGGGG + Intronic
1055809277 9:80133471-80133493 CTTTCTGTTTTTTGCATTTGTGG + Intergenic
1055957817 9:81791058-81791080 GTTTTTGTTTTTTGTTTTTTTGG - Intergenic
1056541988 9:87579707-87579729 ATTTCTGTTTTTTTCAATTCAGG + Intronic
1057397482 9:94692790-94692812 CTTTGTGTTTACTGCATTCCTGG - Intergenic
1057665474 9:97041425-97041447 GTTTGTTTGTTTTGTATTTTTGG - Intergenic
1057756700 9:97844513-97844535 ATTTGGGTTTTTTCCATTTTTGG - Intergenic
1057832602 9:98418562-98418584 TTTTTTGTTTTTTGGATTTTTGG - Intronic
1058048552 9:100383471-100383493 TTTTCAGGTTTTTGCATTTCTGG + Intergenic
1059969099 9:119646236-119646258 TTTTTTTTTTTTTGCATCTCTGG - Intergenic
1060255884 9:122030758-122030780 TTTTGTATTTTTTGTATTTTTGG - Intronic
1060620652 9:125062702-125062724 GTTTGTTTGTTTTGCAATTTTGG - Intronic
1061459991 9:130729904-130729926 TTTTTTTTTTTTTGCATTTTTGG + Intronic
1061463970 9:130763176-130763198 CTTTTTTTTTTTTTCATTTCAGG + Intronic
1061676396 9:132218484-132218506 TTTTGTTTTTTTTGTTTTTCTGG + Intronic
1061693727 9:132355430-132355452 GTTTATGTAATTTACATTTCAGG - Intergenic
1062304999 9:135900735-135900757 CTTTGAGTTTTTTTTATTTCTGG - Intronic
1185466209 X:356006-356028 GTTTGCCTTTTTTTCATTTTGGG - Intronic
1185698018 X:2210432-2210454 GGTTATGTTTTCTGCAGTTCGGG - Intergenic
1186067865 X:5785862-5785884 CTTTCTCTTTTTTGCATTTAAGG - Intergenic
1186956754 X:14690757-14690779 GTTTGTGTTTGCTGCCTTACTGG + Exonic
1187134262 X:16531439-16531461 GTTTGTGATCTTTGTGTTTCAGG - Intergenic
1187700538 X:21960900-21960922 GTTATTGTTTTTTGTCTTTCTGG + Intronic
1188399454 X:29727152-29727174 GTGTCTTTTTTTTGTATTTCTGG - Intronic
1188869489 X:35356983-35357005 CTTTGTCTTTTTTACCTTTCTGG + Intergenic
1188945150 X:36291619-36291641 TTTTTTTTTTTTTGCATGTCAGG - Intronic
1189208235 X:39260129-39260151 TTTTTTTTTTTTTGCATTGCTGG - Intergenic
1189244318 X:39551686-39551708 ATTTGTCTTTTTTCCATATCTGG - Intergenic
1189539224 X:41969060-41969082 GTTTCTGTTCTTTTCATTTTGGG + Intergenic
1189546013 X:42043287-42043309 GTTTGTGTTCTTTGTTTTCCAGG - Intergenic
1189561263 X:42193646-42193668 GTTTTTGTTTTTTGTTTTTTTGG + Intergenic
1189647976 X:43154889-43154911 TTCTGTGTTTTTCTCATTTCTGG - Intergenic
1190568605 X:51758771-51758793 GTTTCTGTCTGTTGCAATTCAGG + Intergenic
1190929140 X:54933667-54933689 GGTTGTGGTTTCTGCATTTCTGG + Intronic
1192538845 X:71950991-71951013 GTGTGTGTATTTTGTATTTTGGG - Intergenic
1192566820 X:72171379-72171401 TTTTTTTTTTTTTGCATTTTTGG - Intergenic
1192605289 X:72510057-72510079 TTTTGGGTTATTTGCATTTGGGG + Intronic
1192610500 X:72561800-72561822 GTTTGAGTTCTTTGTAATTCTGG - Intronic
1193021120 X:76794686-76794708 GTGTGTGTTTTATGTATTGCTGG + Intergenic
1193139637 X:78013933-78013955 GTTTGTGTTTCTTCCATTAATGG + Intronic
1193160489 X:78223299-78223321 GTTTTTGTTTTTTGGTTTTTTGG - Intergenic
1193422394 X:81297173-81297195 TTTTGTTTGTTTTTCATTTCAGG + Exonic
1193459974 X:81778577-81778599 TTTTGTGTGTTTTAAATTTCAGG + Intergenic
1193973868 X:88092829-88092851 GTTTGTGTTTTTTCCCCTTTTGG - Intergenic
1194653937 X:96548589-96548611 GTTTGTGTGTTTTCCCTTTAGGG + Intergenic
1194851593 X:98876504-98876526 TTTTTTTTTTTTTGCTTTTCAGG + Intergenic
1195511373 X:105719279-105719301 GTATGTGTTTTTTTTGTTTCTGG - Intronic
1195620360 X:106947494-106947516 GTTTTTGCTTTGTGTATTTCTGG + Intronic
1195620379 X:106947815-106947837 GTTTTTGCTTTGTGTATTTCTGG - Intronic
1196343804 X:114628418-114628440 TTTTTTTTTTTTTGCATTTTTGG + Intronic
1197313430 X:124934492-124934514 TATTGTGTATTTGGCATTTCAGG + Intronic
1197607402 X:128600273-128600295 CTTGGTCTTATTTGCATTTCTGG - Intergenic
1198410745 X:136364598-136364620 TTTTGTGTTTTTTTCATTGTAGG + Intronic
1198616919 X:138468322-138468344 CTTTGTTTTTATTGCATTTTTGG - Intergenic
1199029772 X:142983502-142983524 ATTTGTGTTATTTGCAGTTTTGG - Intergenic
1199567306 X:149229650-149229672 GTTTGTTTTTCTTTCAATTCAGG + Intergenic
1200384259 X:155874236-155874258 GTTTTTGTTTTTTTCCTTACAGG + Intergenic
1200792317 Y:7310583-7310605 GCTTGTTTTTCTTGCGTTTCTGG + Intergenic
1200815916 Y:7532198-7532220 TTTTGTGTTCATTTCATTTCAGG - Intergenic
1202088184 Y:21161176-21161198 TTTTCTATTTGTTGCATTTCTGG + Intergenic