ID: 1050719303

View in Genome Browser
Species Human (GRCh38)
Location 9:8567188-8567210
Sequence GGGTTCCATGATGAATTTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050719299_1050719303 9 Left 1050719299 9:8567156-8567178 CCAGAAATGCAAAAAACACAAAC 0: 1
1: 0
2: 2
3: 71
4: 797
Right 1050719303 9:8567188-8567210 GGGTTCCATGATGAATTTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050719303 Original CRISPR GGGTTCCATGATGAATTTGG CGG Intronic
No off target data available for this crispr