ID: 1050721894

View in Genome Browser
Species Human (GRCh38)
Location 9:8600363-8600385
Sequence CTAGTGCTGCACTGGGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050721887_1050721894 22 Left 1050721887 9:8600318-8600340 CCAGGGGCAGTCTAGGCCACAAA 0: 1
1: 0
2: 0
3: 19
4: 156
Right 1050721894 9:8600363-8600385 CTAGTGCTGCACTGGGCTCACGG No data
1050721888_1050721894 6 Left 1050721888 9:8600334-8600356 CCACAAATACTGAAATTCCTAGG 0: 1
1: 0
2: 18
3: 106
4: 540
Right 1050721894 9:8600363-8600385 CTAGTGCTGCACTGGGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050721894 Original CRISPR CTAGTGCTGCACTGGGCTCA CGG Intronic
No off target data available for this crispr