ID: 1050722052

View in Genome Browser
Species Human (GRCh38)
Location 9:8601321-8601343
Sequence TCCAGGCCTTCTTTTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050722052_1050722059 12 Left 1050722052 9:8601321-8601343 CCACCCTTAAAAGAAGGCCTGGA 0: 1
1: 0
2: 1
3: 13
4: 178
Right 1050722059 9:8601356-8601378 CTGCAGACTGTAGAGCCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050722052 Original CRISPR TCCAGGCCTTCTTTTAAGGG TGG (reversed) Intronic
901782671 1:11604270-11604292 TCCAGTCTTGCTTTTACGGGTGG - Intergenic
902576581 1:17381753-17381775 TCAGGGCCTCCTTTTGAGGGAGG - Intronic
902883859 1:19390920-19390942 TCCAGTCCTTGTTTTAAAGAAGG + Intronic
903047484 1:20575533-20575555 ACCAGGCCTTTCTCTAAGGGAGG + Intergenic
904891904 1:33785598-33785620 TGTAAGCCTTCTTTTAAGAGAGG - Intronic
905947893 1:41918915-41918937 TCCAGACCTTTTTTGAAAGGGGG + Intronic
908935560 1:69372136-69372158 TTCAGGCCCTGTTTTAAGGCAGG + Intergenic
909201278 1:72692972-72692994 TCAAGGTCATATTTTAAGGGAGG - Intergenic
916870191 1:168905518-168905540 TCCATTGCTTCTTTTAAGGAAGG - Intergenic
917400063 1:174637974-174637996 TCCAGGCCTACTTATAATGAGGG - Intronic
924204502 1:241697937-241697959 TTCATGCCTTCTCTTAATGGTGG + Intronic
924757318 1:246953141-246953163 TTCAGGCCTCCTTTGGAGGGAGG + Intronic
1062892269 10:1072614-1072636 TCAAGGCCTTATTTTAAAGATGG + Intronic
1065153208 10:22843442-22843464 TCCGGGCCTTCTGAAAAGGGTGG - Intergenic
1065908544 10:30281225-30281247 GCCAAGCCATCTTTTATGGGGGG - Intergenic
1066977087 10:42378951-42378973 TCCTTGCCTTTTTTTAAGAGAGG + Intergenic
1070273143 10:74977619-74977641 TCCATACCTACTTTTAAGAGTGG - Intronic
1071793397 10:88980300-88980322 TTCAGGCCTTCTTTGAAGCTAGG + Intronic
1072223435 10:93347079-93347101 TCTCGGCCTTGTTTTAGGGGTGG - Intronic
1074180105 10:111053766-111053788 TACAGAGCTTCTTTTAAAGGTGG - Intergenic
1075277239 10:121105209-121105231 TGCAGGCCCTATTTTTAGGGGGG + Intergenic
1076833374 10:133007844-133007866 TCCAGCCCCTCTTTCCAGGGAGG - Intergenic
1078511949 11:11991225-11991247 TCCAGGCCATCTTTTCTAGGCGG - Intronic
1081255916 11:40894773-40894795 TCCAGGCCTTGAATTATGGGTGG - Intronic
1082691101 11:56306237-56306259 TCAAGGACTTCTTGTAAGGATGG + Intergenic
1085091279 11:73716427-73716449 TCCAGGGCTTTTTTGGAGGGAGG - Intronic
1089323892 11:117644296-117644318 TCCAGCCCTCATTTTAAAGGCGG + Intronic
1094036571 12:26078323-26078345 CCAAGGCCATCTTTTAAGAGAGG - Intronic
1094413856 12:30197455-30197477 TCCAGGACTTCTTTTCCGAGGGG - Intergenic
1098942911 12:76558880-76558902 TCCCGGCCTTCTTGTAACGTAGG - Intronic
1100819613 12:98419106-98419128 TCCTGCCCTTCTCTTTAGGGTGG + Intergenic
1102128172 12:110502315-110502337 TCCGAGCCTGCTTTTTAGGGCGG + Exonic
1104013327 12:124947270-124947292 TCCATGCCTTCTTGGGAGGGTGG - Exonic
1104960909 12:132488426-132488448 TCCTGGCCTTCTGTCCAGGGAGG + Intergenic
1105465639 13:20637168-20637190 TACAGGGTTTCTTTTGAGGGTGG + Intronic
1105500693 13:20969056-20969078 TTTAGCCGTTCTTTTAAGGGAGG - Intergenic
1105801691 13:23909451-23909473 TGCAGGGTTTCTTTTCAGGGTGG - Intergenic
1106874107 13:34053721-34053743 TTCAGGCATTCTTGTAAGGCAGG + Intergenic
1107359582 13:39603599-39603621 TCTACGGCTTCTTTTAACGGCGG - Intergenic
1110740514 13:78990632-78990654 ACTAAGACTTCTTTTAAGGGTGG + Intergenic
1111899830 13:94187184-94187206 TCCAAGCCTTCTTTTGAGGGAGG - Intronic
1115437511 14:33392206-33392228 TCCAGGGGTAATTTTAAGGGCGG - Intronic
1115582657 14:34777093-34777115 CCCAGTCCTTCCTCTAAGGGAGG + Intronic
1115640603 14:35333448-35333470 TCCAGGCCTACCTTGAAGGGAGG + Intergenic
1121124701 14:91398747-91398769 TGCAGGCCTTTTGTTAAGTGTGG + Intronic
1122506659 14:102235992-102236014 TCCGGGCCTTGTTTTAAGTGTGG + Intronic
1124060519 15:26289634-26289656 TCTAGACCCTCTTTTCAGGGTGG - Intergenic
1124589335 15:31039742-31039764 TCCAGTCCCTCCTTTAATGGTGG + Intronic
1124840931 15:33241460-33241482 TCCAGGCGGCCTTTGAAGGGCGG - Intergenic
1125727685 15:41876496-41876518 CTCAGGCTTTCTTTTCAGGGAGG + Intronic
1134225043 16:12383213-12383235 TCCAGACCTTCCTGTTAGGGTGG + Intronic
1137401149 16:48155436-48155458 TCCAGGTCTTTTTTTTTGGGGGG + Intronic
1137585239 16:49660315-49660337 TCCAGGGCTTCGTCTAAAGGAGG + Intronic
1140947384 16:79782097-79782119 TCCAGGACTTCTTCTAAGTCAGG - Intergenic
1141406962 16:83803059-83803081 TCCCTGCCTTCTTTCAAGGCAGG + Intergenic
1141623767 16:85250784-85250806 TGCAGGGCTTCTTTTGGGGGTGG - Intergenic
1143540403 17:7565085-7565107 CCCAGCCCTTCTTTCAAGGAGGG - Intronic
1147673096 17:42188260-42188282 TCCAGGCCTTCTTTCAAGCAAGG + Intergenic
1148496298 17:48055133-48055155 TCCAGGGCTTCTGTTCAGGTTGG + Intronic
1150158813 17:62876426-62876448 TCCAGGGCTCCTTTTGAGGTGGG - Intergenic
1151335489 17:73437284-73437306 TCCAGGAACTCTTTCAAGGGGGG + Intronic
1151763171 17:76118896-76118918 TCCAGGACTTTTTTTAGGAGGGG - Intronic
1152029831 17:77835038-77835060 TCCAGGCCTCCAGTTAAGGGGGG - Intergenic
1152294374 17:79458044-79458066 CCCAGGCCATCTTTGCAGGGCGG + Intronic
1155323677 18:24644528-24644550 TCCATTCCTTTTTTTGAGGGGGG - Intergenic
1155463675 18:26112083-26112105 TTCAGGACTTCTTGTAAGGCAGG + Intergenic
1157890435 18:51410998-51411020 TCCAGCCCTTCTTTGTAGTGAGG + Intergenic
1158517948 18:58146445-58146467 TCCATGCCATCTTTAAAGAGGGG + Intronic
1159667366 18:71178117-71178139 ACCAGGGCTTCTTGTAAAGGGGG - Intergenic
1159670839 18:71218931-71218953 TCCAGGCTATCTTGTAAGAGAGG - Intergenic
1160983666 19:1827806-1827828 TCCAGGCCCTCTTTGGAGGGTGG + Exonic
1163239762 19:16053593-16053615 TCCAGGGCTTTTTTTGTGGGGGG + Intergenic
1164047228 19:21553077-21553099 TTCAGGACCTCTTCTAAGGGAGG + Intronic
1165847013 19:38824682-38824704 TCCAAGCTTTCTTTTCATGGAGG + Intronic
925914077 2:8592280-8592302 TCCAGGGCTTCTCAAAAGGGAGG - Intergenic
929355972 2:41025088-41025110 ACCAGGCCTGCTTTTAATGCAGG + Intergenic
929997406 2:46837356-46837378 TCCAGGCCTTCTTCACAGGGAGG + Intronic
931005339 2:57844324-57844346 TCCAGGTATTTTTTTAAAGGAGG - Intergenic
937287544 2:120762736-120762758 TGCAGGCCTTCCTTTCATGGTGG - Intronic
938181919 2:129191656-129191678 TCCACGCCTTCTTTTATGCCTGG + Intergenic
940050646 2:149459372-149459394 TTCAGCCATTCTTTTAAGGTAGG - Intronic
940789608 2:158018481-158018503 TCCCATCCTTCTTCTAAGGGAGG + Intronic
941066234 2:160906063-160906085 TCCTTGCCTGCTTTTATGGGAGG - Intergenic
946373518 2:219294811-219294833 CTCAGGCCTGCTTTTAGGGGTGG + Intronic
948508036 2:238444237-238444259 TCAAGGCCTTCTGCTCAGGGTGG + Intronic
1170284494 20:14691433-14691455 TCTAGGCATTCTTTTCAAGGTGG - Intronic
1170527394 20:17253322-17253344 TCCAGGATTTATTTTAAGGGTGG - Intronic
1170768392 20:19311399-19311421 TCCAGGCATTCTGCTAATGGTGG + Intronic
1171180064 20:23085356-23085378 ACCAGGACTGCTTTGAAGGGGGG - Exonic
1172897381 20:38309897-38309919 TCCAGCAGTTCTTGTAAGGGCGG - Intronic
1173058063 20:39635653-39635675 CCCAGACCTTCTTTCCAGGGTGG + Intergenic
1173314148 20:41928465-41928487 TACAGGGTTTCTTTTGAGGGTGG - Intergenic
1174928907 20:54792290-54792312 TTCAGGACTTCTTGTAAGGCAGG + Intergenic
1176678592 21:9804602-9804624 TCTAGGACTTCTTTAAAGAGAGG - Intergenic
1180928916 22:19575852-19575874 TCCAGGGCTGCTTTTAAGTTGGG - Intergenic
1183229462 22:36572189-36572211 ACCAGGCCTTGTTCTAAGAGCGG + Intronic
1184716610 22:46286167-46286189 CCCAGGCATTCTTTTGAGAGGGG + Intronic
952334671 3:32393408-32393430 CCCAGCCCATCTTTTAAGGATGG - Intronic
953717238 3:45326044-45326066 GCCAGGCTTTCTTTGAAGGTAGG - Intergenic
959159356 3:102705038-102705060 TACAGGTCTGCTTTTATGGGTGG + Intergenic
959881583 3:111449384-111449406 TTCAGGACCTCTTTTAAGGCAGG - Intronic
965080234 3:164023894-164023916 CCCTGGCCTTGTTTTAAGTGTGG - Intergenic
967731938 3:192915186-192915208 ACCAGGCCCTCATTTCAGGGCGG - Intronic
970055138 4:11963540-11963562 TTCAGGCATTCTTGTAAGGCAGG + Intergenic
970127047 4:12826063-12826085 TCCAGGGCTTCTTTTTATGGAGG + Intergenic
970695002 4:18666774-18666796 TCCAGTCCTTTTATTAAGGTTGG + Intergenic
972933387 4:44102820-44102842 TTCAGGGCCTCTTTTAAGGCAGG + Intergenic
973007421 4:45030037-45030059 TGCAGGCCTTCTTGAAAGGTGGG + Intergenic
973649021 4:52979051-52979073 ACCAGGCCTTTTTTTGGGGGGGG + Intronic
973681239 4:53322432-53322454 TCTAGTCCGTTTTTTAAGGGTGG - Intronic
973779310 4:54273182-54273204 TCCAGGCCTTTTTGAAGGGGTGG + Intronic
974338475 4:60582801-60582823 TCCAGGCTTGCTTTTAAGGTTGG + Intergenic
976637443 4:87300965-87300987 TCCAGGCTTTCGTTTCAGGAGGG + Intergenic
976789391 4:88860702-88860724 TCCAAGCTTTCTTTTAATGTAGG + Intronic
979208835 4:118075966-118075988 TTAAGGACTTCTTTTAAGGCAGG + Intronic
985396968 4:189554368-189554390 TCTAGGACTTCTTTTAAGAGAGG + Intergenic
986038207 5:3961016-3961038 ACCATGCATTCTTTAAAGGGAGG - Intergenic
986226044 5:5813633-5813655 TCCCTGTCTTCTTTTTAGGGAGG - Intergenic
986302698 5:6490782-6490804 TAAAGGCATTCTTTTGAGGGAGG + Intronic
987556204 5:19454046-19454068 TCCAGGGCTTCTTTTATAAGGGG + Intergenic
991270512 5:64773485-64773507 TACAGGGTTTCTTTTTAGGGTGG + Intronic
992839949 5:80678686-80678708 TCCAGGCCTTGTATTCAGGGCGG + Intronic
993634156 5:90324433-90324455 TTCAGGACTTCTTGTAAGCGAGG + Intergenic
993932655 5:93960088-93960110 TCCAGGGCTTTTTTTGGGGGGGG - Intronic
994070074 5:95590858-95590880 TCCAGCCCTTCTTCAAAGGTGGG + Intronic
994339189 5:98605708-98605730 TCCAGGCCTTCACTTAGGGAAGG + Intergenic
994599683 5:101887014-101887036 GCCAGGCCTTATTTTATTGGTGG - Intergenic
994723811 5:103411150-103411172 TGCATGCATTCTTTTAAGGAAGG - Intergenic
995872896 5:116761220-116761242 TCCAGACCTTCTTTTTGTGGCGG + Intergenic
997083364 5:130766736-130766758 TTAAAGCCTTCTTCTAAGGGTGG + Intergenic
997501317 5:134376454-134376476 TCTAAGCTTTCTTTTTAGGGTGG - Intronic
997766238 5:136506385-136506407 TCCAGGCCTGCTTTTGATAGGGG + Intergenic
1003773574 6:9335343-9335365 TCCAGGCTGTCTTTTCAAGGGGG + Intergenic
1004620250 6:17325177-17325199 CCCAGTCCTTGTTTTAAGTGCGG - Intergenic
1009302028 6:62036063-62036085 TCCAAGTCTTCTCCTAAGGGTGG + Intronic
1013016063 6:106161438-106161460 TCCAGGGTTGCTTTTTAGGGAGG + Intergenic
1013320034 6:108979161-108979183 TTCAGGAGTTCTTGTAAGGGAGG + Intergenic
1015336507 6:132045116-132045138 ACCATGGCTTCTTTTAAGGAAGG - Intergenic
1017762611 6:157582403-157582425 TTCAGGACCTCTTTTAAGGTAGG + Intronic
1018476791 6:164150636-164150658 TCCAGGCCCTCTTTCTAGGGTGG + Intergenic
1020640104 7:10743892-10743914 TTCAGGCCCTCTTGTAAGGCAGG - Intergenic
1021166793 7:17352619-17352641 TTCAGGACTTCTTGTAAGGCAGG + Intergenic
1021172545 7:17415269-17415291 TCCAGGCATTCTTTTACACGTGG + Intergenic
1021247584 7:18282848-18282870 TTCAGTCCTAATTTTAAGGGTGG - Intronic
1022830917 7:34065868-34065890 TCCAGCCCTTCTCTGAAAGGAGG + Intronic
1023467297 7:40470075-40470097 TAAAGGCCTTCTTTTTTGGGAGG + Intronic
1023909012 7:44540908-44540930 TCCAGGCCTGCAGTTGAGGGAGG - Intronic
1024787295 7:52922768-52922790 TCCTTGCCTTCTTTTAATGAGGG - Intergenic
1025975572 7:66366929-66366951 TCCAGGCCATGTTTTGAGTGAGG - Intronic
1027128035 7:75571116-75571138 TAAAGGCCTTCTTTGAAGGCAGG - Intronic
1028832617 7:95343739-95343761 TCAAGGCCATATTTGAAGGGAGG + Intergenic
1029193123 7:98785789-98785811 TCCAGACCTTCTTCCATGGGCGG - Intergenic
1030185681 7:106759549-106759571 GCAAAGCTTTCTTTTAAGGGTGG + Intergenic
1030434945 7:109505645-109505667 TTCAGGCCTACTTGTAAGGTTGG + Intergenic
1030897110 7:115074168-115074190 CCCAGCCCTTCTTCTAATGGCGG - Intergenic
1031898953 7:127389083-127389105 TAAGGGCCTTGTTTTAAGGGAGG - Intronic
1033310787 7:140260319-140260341 TCCTGGCCTCCTAGTAAGGGCGG + Intergenic
1033850649 7:145490379-145490401 TCTATGCTTACTTTTAAGGGGGG - Intergenic
1035891325 8:3346699-3346721 TCCAGCCATTCTGTAAAGGGAGG + Intronic
1040979023 8:53226419-53226441 TCCAGACCTTCTTACCAGGGTGG + Exonic
1043065001 8:75557964-75557986 TCCAGGACTTCTTTAAATAGAGG - Intronic
1043949906 8:86297354-86297376 TTCAGTCCTTCTTTTAGGGTAGG + Intronic
1044289813 8:90454499-90454521 TGCATGCCTTCATTTGAGGGTGG - Intergenic
1044309679 8:90679382-90679404 TCGAGCAGTTCTTTTAAGGGAGG - Intronic
1044536113 8:93357768-93357790 TTCAAGTCTACTTTTAAGGGTGG + Intergenic
1045057503 8:98382240-98382262 TCCAGGCCTGCTTCTCAGGCAGG - Intergenic
1045578114 8:103447975-103447997 TCCAGGCCTATTTTTAAAGCTGG - Intergenic
1048390958 8:133963985-133964007 TCCATGGCTTCTTCTCAGGGAGG + Intergenic
1049352292 8:142170737-142170759 TGCAGGCCTTCTGTCCAGGGAGG + Intergenic
1049701819 8:144018439-144018461 TCCAGAACTTCTTTTCAAGGTGG + Intronic
1050722052 9:8601321-8601343 TCCAGGCCTTCTTTTAAGGGTGG - Intronic
1051169765 9:14308798-14308820 CCAAGCCCTTTTTTTAAGGGAGG + Intronic
1053330982 9:37206777-37206799 TCCTGGCCACCTTGTAAGGGAGG - Intronic
1056314947 9:85379203-85379225 TCTATGTCCTCTTTTAAGGGAGG + Intergenic
1058054261 9:100433790-100433812 TCCAGGCCTTGCTTGTAGGGAGG + Intronic
1061294181 9:129667910-129667932 TCCAGGCCTTCTCCTAAGAAGGG + Intronic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1203663759 Un_KI270754v1:7137-7159 TCTAGGACTTCTTTAAAGAGAGG - Intergenic
1188340793 X:28998841-28998863 TCCAAGCCTTCTTTCAACAGCGG + Intronic
1190982729 X:55470803-55470825 TGCCGGCCCTCTTTTAGGGGTGG - Intergenic
1190985970 X:55502380-55502402 TGCCGGCCCTCTTTTAGGGGTGG + Intergenic
1191744731 X:64474131-64474153 TACATGCCTTCTTTTAAGAAAGG + Intergenic
1191947956 X:66555842-66555864 TTCAGGCACTCTTTTAAGGCAGG - Intergenic
1192035607 X:67559607-67559629 TCCAGGTTTTCTTTTAAAGAAGG + Intronic
1192155005 X:68738209-68738231 TTCAGGAGTTCTTTTAGGGGAGG - Intergenic
1193277560 X:79606819-79606841 TTCATGACTTCTTTTAAGGCAGG - Intergenic
1193769597 X:85573288-85573310 TTCAGGACCTCTTTTAAGGCAGG - Intergenic
1193782237 X:85717819-85717841 TTCAGGAATTCTTGTAAGGGAGG + Intergenic
1193906248 X:87248284-87248306 TTCAGGACTTCTTGTAAGGCAGG + Intergenic
1197094114 X:122573452-122573474 TCCAGGACCTCTTGTAAGGCAGG - Intergenic
1197474372 X:126902455-126902477 TTCAGGACCTCTTGTAAGGGAGG - Intergenic
1197858990 X:130949715-130949737 TCCAGCCCTTCTGGTAAGGGAGG - Intergenic
1200915609 Y:8568713-8568735 TCAAGGCCTTCTTATTATGGAGG + Intergenic