ID: 1050726122

View in Genome Browser
Species Human (GRCh38)
Location 9:8651218-8651240
Sequence GAAAATGCAGAGATCCATCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050726122_1050726129 25 Left 1050726122 9:8651218-8651240 CCACGATGGATCTCTGCATTTTC 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1050726129 9:8651266-8651288 ATTCTCCTGAGTGAGCTATTTGG No data
1050726122_1050726131 27 Left 1050726122 9:8651218-8651240 CCACGATGGATCTCTGCATTTTC 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1050726131 9:8651268-8651290 TCTCCTGAGTGAGCTATTTGGGG No data
1050726122_1050726130 26 Left 1050726122 9:8651218-8651240 CCACGATGGATCTCTGCATTTTC 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1050726130 9:8651267-8651289 TTCTCCTGAGTGAGCTATTTGGG No data
1050726122_1050726132 28 Left 1050726122 9:8651218-8651240 CCACGATGGATCTCTGCATTTTC 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1050726132 9:8651269-8651291 CTCCTGAGTGAGCTATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050726122 Original CRISPR GAAAATGCAGAGATCCATCG TGG (reversed) Intronic
905899614 1:41572601-41572623 GAAAATGCAGTGTCCCATGGGGG - Intronic
909291772 1:73891751-73891773 CAAGATGCAGAGATCAAACGCGG + Intergenic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
910659597 1:89657155-89657177 GAAAATGCAGATGTCCAATGAGG + Intronic
911197307 1:95007530-95007552 CAAAATGCAAAGTTCCATCAAGG + Intronic
915719528 1:157974271-157974293 GCAAAGGCAGAGAGCCATGGGGG - Intergenic
918022349 1:180707376-180707398 GAAAATACATAGATACATAGAGG - Intronic
922963111 1:229664894-229664916 GAGGATGCAGAGAGCCAGCGGGG - Intergenic
923771490 1:236941773-236941795 GAGAATGCAGAGGTCCCTAGAGG - Intergenic
923944109 1:238863274-238863296 CACAAAGCAGGGATCCATCGTGG - Intergenic
924239521 1:242027783-242027805 TAAAATACAGAGAACCATTGTGG - Intergenic
924687831 1:246313437-246313459 GAAAATGCTGCCACCCATCGGGG + Intronic
1062798791 10:364059-364081 AAAGATCCAGATATCCATCGTGG - Intronic
1062883689 10:999571-999593 GAAAATGCAGAAATCCACACTGG - Intronic
1067545214 10:47187946-47187968 GAGAAGCCAGTGATCCATCGTGG - Intergenic
1069600735 10:69705182-69705204 GAAAATGTAAAGATCCAGCCTGG - Intergenic
1071248767 10:83793438-83793460 GAAAATGCAGGGATTCATCTGGG - Intergenic
1071827680 10:89341304-89341326 AAAAGGGCAGAGATCCATCCAGG + Intronic
1072289315 10:93947998-93948020 CCCAATGCAGATATCCATCGAGG + Intronic
1074058896 10:109946948-109946970 GAAGATGCACAGATGAATCGTGG - Intronic
1075962625 10:126582363-126582385 GAAACCGTAGAGATCCATCAGGG - Intronic
1076514356 10:131034950-131034972 GAAAATGGAGAGATAAATCGTGG - Intergenic
1079236867 11:18697407-18697429 GAAAAGGAAGAGACCCATTGTGG + Intronic
1082703845 11:56468049-56468071 GAAAATGCACATATACATCATGG + Intergenic
1083556087 11:63629528-63629550 GAAAATGCAGGGATACAGAGAGG + Intronic
1086167940 11:83801263-83801285 GACAATGGAGGGACCCATCGAGG - Intronic
1087085298 11:94212199-94212221 GAAAGGGCAGAGATCCAGTGGGG + Intergenic
1087841424 11:102924594-102924616 GAGAATGAAAAGATCCATCCAGG + Intergenic
1090876315 11:130791720-130791742 AAGAATGCAGAGATCCTTGGTGG + Intergenic
1091291965 11:134445650-134445672 GCAAATGATCAGATCCATCGGGG + Intergenic
1092567094 12:9678016-9678038 GGAAATGCACAGATCCAGCAGGG - Intronic
1097160035 12:57039508-57039530 GACAATGCAGAGATCCCTGTAGG + Intronic
1097322637 12:58243459-58243481 GATCATGCAGAGCTCCATGGGGG + Intergenic
1098367392 12:69719106-69719128 AAAAATGCAGAGCTCCAGAGTGG - Intergenic
1100550296 12:95640724-95640746 GAAAATAAAGAGTTCCATCATGG - Intergenic
1101071727 12:101082397-101082419 GAAAATGGACAGATACATCCAGG + Intronic
1101821312 12:108186149-108186171 GAAAAGGCAGAGACCCACTGAGG - Intronic
1103997584 12:124840168-124840190 AAAAATGCAGATAGCCAACGGGG - Intronic
1107218348 13:37949153-37949175 GAAAGTGCAGAGAGCCAGAGAGG - Intergenic
1108774488 13:53748794-53748816 GAAAATTCAGATATCCAACTTGG - Intergenic
1108810102 13:54211997-54212019 GAGAATCCAGAGATGCCTCGTGG + Intergenic
1112475294 13:99726512-99726534 AAAACTGGAGAGATCCATGGGGG + Intronic
1114756105 14:25261925-25261947 GAAAATTCAAGGATCAATCGGGG - Intergenic
1119574493 14:75706546-75706568 GAAAATGCTAGGATCCATTGTGG + Intronic
1122803617 14:104245408-104245430 GGAAACCCAGAGATCCATCCTGG - Intergenic
1124173680 15:27402386-27402408 TAAAATGCTGATATCCATAGAGG - Intronic
1124384521 15:29195386-29195408 GAAACTGCAGAGAGCCACCTCGG - Intronic
1129098170 15:73231717-73231739 GAATATGCAGGCATCCATCCTGG + Intronic
1129373554 15:75113236-75113258 GAAAAATCAGAGATCCATAGAGG - Intronic
1135880776 16:26253854-26253876 TAAAATGCAGATTTCCATCTGGG + Intergenic
1135979616 16:27137309-27137331 GAAAATCCTGAGATCCTTCAAGG - Intergenic
1137237818 16:46629716-46629738 GAAAAAGCAGACACCCAGCGAGG + Intergenic
1144028964 17:11302842-11302864 GAAAAAGCAGAGAGTCATCCAGG + Intronic
1146449044 17:32957454-32957476 GAAAATGGAGAAATACATTGTGG - Intergenic
1146529370 17:33595159-33595181 GAAATTGCAGAGAGCCATGATGG + Intronic
1150465255 17:65387146-65387168 GAATATGCAGAGACCCGGCGCGG - Intergenic
1151152305 17:72098576-72098598 GAAAATGCTGAGATCCAAAGAGG - Intergenic
1152708314 17:81857129-81857151 TAAAATGCAGAGGGCCATCCTGG - Intronic
1154510353 18:15093742-15093764 GAAAATAAAGAGATACATTGAGG - Intergenic
1155333023 18:24737251-24737273 CCAAATGCAGAGAAGCATCGAGG - Intergenic
1156218295 18:35025357-35025379 GAACATGCAAAGATCCACAGAGG - Intronic
1157552416 18:48590725-48590747 GAAAAAGCAGACATCCATTTCGG + Intronic
1157813418 18:50714189-50714211 AAAAATGTATAGATCCATTGGGG - Intronic
1159100657 18:63954435-63954457 GAAGATGGAGATATTCATCGAGG + Exonic
1159691813 18:71497438-71497460 GAAAATGCAGTGGTCAATGGGGG + Intergenic
1167936757 19:52915144-52915166 GAAAATGCAAAGATCCACAAGGG + Intergenic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
925853648 2:8108361-8108383 GTAAATGCAGAAATCTATGGAGG + Intergenic
929163300 2:38855139-38855161 GAGATTGCAGAGATTCGTCGGGG + Exonic
931510985 2:62993875-62993897 GAAAAGGCAGAGATCAATACAGG + Exonic
934696430 2:96403931-96403953 GAAACTGCAGGGATCCAAAGAGG + Intergenic
934966349 2:98727240-98727262 GAAAATGCAGCAATCCAGCCAGG + Intronic
935641686 2:105296843-105296865 GAAGATGCAGAGTTCAATCAGGG + Intronic
935728606 2:106046014-106046036 TAAAATGGAGAGATCCATGAAGG - Intergenic
936473376 2:112818590-112818612 AAAAATGCAGGGATCCAGCCTGG + Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937873981 2:126806588-126806610 GAAAAATAAGAGATCCACCGTGG - Intergenic
938505570 2:131878191-131878213 GAAAATAAAGAGATACATTGAGG - Intergenic
941052133 2:160746901-160746923 GCAAATGCAGAGACCCAGCAGGG - Intergenic
941910573 2:170760637-170760659 GAAAATACAAAGATCTATGGTGG + Intergenic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
942985299 2:182134014-182134036 GCAAATGCACAGATCCTTAGAGG + Intergenic
948621477 2:239237780-239237802 GGCAATGCAGAGATCAAACGTGG + Intronic
1170008066 20:11690522-11690544 TAAGATGCAGAGACCCATCCAGG + Intergenic
1172577275 20:36018890-36018912 GAAAATGAGGAGATTCATCTGGG + Intronic
1173417864 20:42873799-42873821 GAAAATCCAGTAATCCATTGAGG - Intronic
1176787512 21:13275660-13275682 GAAAATAAAGAGATACATTGAGG + Intergenic
1177252281 21:18609755-18609777 GGAAATGTAGAGATGCATCAAGG + Intergenic
1177758405 21:25374040-25374062 GAAAAAGCAGAGAGCTCTCGTGG - Intergenic
1184757032 22:46522701-46522723 GGAAAAGCAGAGATCCAGCCTGG - Intronic
952716078 3:36482340-36482362 GAAAAGGCAGAGAGCCATCCTGG - Intronic
954689129 3:52386525-52386547 GCATATCCAGAGATCCACCGAGG - Intronic
955949818 3:64231815-64231837 GAAGATGCAGAGGTCCAAAGAGG + Intronic
957560381 3:81813661-81813683 CAAAATGCAAAGATCCAGCTTGG + Intergenic
961378217 3:126481160-126481182 TAAAATGGACAGATCCAGCGGGG - Intergenic
962657969 3:137568438-137568460 GAATAGGCAGATATCCATGGTGG + Intergenic
969241707 4:5903002-5903024 GAAAATGCAGAGGCCCAGGGAGG - Intronic
969970443 4:11041643-11041665 GAAAAAGCAGATATCCAAGGTGG + Intergenic
969999062 4:11345433-11345455 GGAAATGCAGGGATCATTCGGGG + Intergenic
971106162 4:23526110-23526132 GAAAATACAGAGAACCTTGGAGG + Intergenic
971767417 4:30850891-30850913 GAAAATGCAGGGAGCCAAGGAGG - Intronic
979114027 4:116798003-116798025 TAAAATGCAGAAACCCATGGTGG - Intergenic
980125330 4:128768847-128768869 GAAAAGGCAGAGAACCATTGGGG - Intergenic
980282391 4:130737861-130737883 GAAACTGCAGAGACCCAAAGAGG - Intergenic
980340773 4:131543054-131543076 GAAAATGCATAAATCAATCTAGG - Intergenic
986188374 5:5467392-5467414 GAAGAAGAAGAAATCCATCGTGG - Intronic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
988342785 5:29996100-29996122 GAAAATGAAGAAATCCAACATGG - Intergenic
989300083 5:39880891-39880913 GAAAATGCAGAGAAGCCTGGTGG - Intergenic
989771269 5:45148988-45149010 GAAAATGCAGAGTTTCTTCAGGG - Intergenic
991958161 5:72016216-72016238 GGAAATGCAGAGATCCACAGAGG - Intergenic
992037814 5:72798301-72798323 GAAAAGGCAGAGATGCAGGGTGG + Intergenic
1001988664 5:176097566-176097588 AAAAATGCAGAGAACAATCAGGG + Intronic
1002179088 5:177420692-177420714 GAAGAAGCAGAGATCCGTGGTGG + Intronic
1002228204 5:177740570-177740592 AAAAATGCAGAGAACAATCAGGG - Intronic
1006417001 6:33910638-33910660 GAAGATGCAGACCTCCATGGCGG + Intergenic
1012400187 6:98835938-98835960 GAAAAAGCGGACCTCCATCGAGG + Exonic
1012761402 6:103307592-103307614 GAAAATGCAGAGACAAATCATGG + Intergenic
1014710146 6:124796774-124796796 GAAAAGGCAGTGATACATCTTGG + Intronic
1015290605 6:131534686-131534708 GAAAATGCAGCGATCCAGTGAGG + Intergenic
1017048693 6:150370867-150370889 GAAGATGTTGAGTTCCATCGAGG + Intronic
1018020248 6:159756147-159756169 GAAAATGCACAGATGTATGGTGG - Exonic
1021012038 7:15481753-15481775 GAAAATGCATAAATGCATCAGGG - Intronic
1023674490 7:42616001-42616023 GAAAATGGAGAGATTCATTTTGG - Intergenic
1028053003 7:86208123-86208145 GAAACTGCAGAGCTCCAAAGAGG + Intergenic
1032186201 7:129728727-129728749 GGAAATGCAAAGAGCCATCGTGG + Intronic
1032850550 7:135791546-135791568 GGAAATGCACAGATTCATCTAGG - Intergenic
1035117139 7:156533983-156534005 GAGAATGAAGAGATCGATCCCGG + Intergenic
1035233662 7:157483030-157483052 AAAAATGCAGAAATCCGTCGAGG - Intergenic
1038345393 8:26727481-26727503 GAAAATGAGCAGATCCATCAAGG - Intergenic
1039956268 8:42209355-42209377 GAAAATGCACATATACACCGAGG + Intergenic
1040634720 8:49259323-49259345 AAAAATCCAGTCATCCATCGAGG + Intergenic
1041380675 8:57251520-57251542 GAAAATGCAGAGTTCTGTGGTGG - Intergenic
1046446834 8:114332359-114332381 GAAATAGAAGAGATCCATGGAGG - Intergenic
1047574544 8:126138202-126138224 CAAAATGCAGAGATCCAGAGTGG - Intergenic
1048942353 8:139412337-139412359 GAAAATTCAGAGATACAATGTGG - Intergenic
1050295831 9:4204552-4204574 AAAAATGCAGAGAACCAGGGAGG + Intronic
1050726122 9:8651218-8651240 GAAAATGCAGAGATCCATCGTGG - Intronic
1050861845 9:10444351-10444373 AAAAATGCATAGCTCCATAGTGG + Intronic
1051907598 9:22114431-22114453 GAAAATGGAGAGGTACATAGAGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1185531813 X:826191-826213 AAAAATGCAGAGAACCCTGGGGG - Intergenic
1194832230 X:98637750-98637772 GAAAACACAGAGATACATGGGGG + Intergenic