ID: 1050726211

View in Genome Browser
Species Human (GRCh38)
Location 9:8652100-8652122
Sequence TACCCTGAGCTGTAAATTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050726211_1050726213 -4 Left 1050726211 9:8652100-8652122 CCTCTAATTTACAGCTCAGGGTA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1050726213 9:8652119-8652141 GGTATTAGGTAAGAAAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050726211 Original CRISPR TACCCTGAGCTGTAAATTAG AGG (reversed) Intronic
905026155 1:34851278-34851300 TATCCTCACCTGTAAAATAGGGG - Intronic
907407037 1:54260033-54260055 TTCCCTGTACTGTTAATTAGGGG - Intronic
907607679 1:55834922-55834944 TTCACTGAGCTGTAACTTAATGG - Intergenic
910169409 1:84361454-84361476 TACCCTGTGCTGTGAGGTAGGGG + Intronic
910912148 1:92247262-92247284 TACCCTGAGCTGTTAAACAATGG - Intronic
911439960 1:97913733-97913755 TACACTGAGTTGTAAGTTGGAGG + Intronic
913165076 1:116177735-116177757 CACCTTTAGCTGTAAAATAGTGG + Intergenic
921553360 1:216566918-216566940 GACCCTGAACTGTAAATGAAAGG - Intronic
922071435 1:222198334-222198356 TACCCAGACCTGGAAATTGGTGG + Intergenic
1064751871 10:18538352-18538374 TCCCCTTACCTGTGAATTAGAGG - Exonic
1065045163 10:21740890-21740912 TGCCCTGAACTGGAATTTAGGGG - Intronic
1066996881 10:42572033-42572055 TTCCCTGAGCTGTCAAATATGGG + Intergenic
1068332270 10:55586482-55586504 TTCCCTCAGCTATAAATTTGAGG + Intronic
1068879072 10:62029585-62029607 TTTCCTCATCTGTAAATTAGGGG - Intronic
1069074336 10:64022125-64022147 AATCCTGAGCTGCAAATTGGAGG - Intergenic
1069082082 10:64099375-64099397 TCCCCTGAGCTGTAAAGTCCAGG - Intergenic
1069406550 10:68106188-68106210 TATCCTGAGAAGTAAATTTGTGG - Intronic
1071794920 10:88994042-88994064 CACCCTTAGCAGCAAATTAGAGG + Intronic
1072460776 10:95616783-95616805 TGCCCTTATCTGTAAAGTAGGGG - Intronic
1075808193 10:125205113-125205135 TGCCCTCACCTGTAAATTGGGGG + Intergenic
1079331649 11:19538280-19538302 TTCCCTGAGCTGTGAATCTGTGG + Intronic
1080408582 11:32001895-32001917 TTTCCTTAACTGTAAATTAGAGG + Intronic
1080457328 11:32429049-32429071 GACTCCGAGCTGTAAATCAGGGG + Intronic
1081007828 11:37769868-37769890 TACTCTGAGCAGTACAGTAGAGG - Intergenic
1087026987 11:93659865-93659887 TATCCTGATCTGTAAATCTGAGG + Intergenic
1089549725 11:119264186-119264208 TACACTTACCTGTAAATTATTGG + Intronic
1096054429 12:48639625-48639647 TACCATGAAATGTAAAGTAGTGG - Intergenic
1105938880 13:25129099-25129121 TTCCCTGAGCTGAAAAATAAAGG + Intergenic
1107056801 13:36114330-36114352 TAATCTGAGCTGTAAATGTGAGG + Intronic
1107408377 13:40136595-40136617 TACCCTGTGCTCTCAATTATTGG - Intergenic
1109734202 13:66459938-66459960 TACATTGAGCTGTAAACTGGGGG - Intronic
1110056595 13:70981956-70981978 AACACTTAGCTGTAAATTAAAGG - Intergenic
1112090094 13:96074030-96074052 TAACCTGAGGTGGTAATTAGAGG + Intergenic
1118607209 14:67513395-67513417 TCCCCTGAGCTATAGATTTGTGG - Intronic
1120147021 14:80989813-80989835 TTCCCTTAGCTGTAAAATACAGG - Intronic
1123774898 15:23569225-23569247 GACCCATAGCTGTGAATTAGTGG + Intronic
1127047069 15:55037177-55037199 TTCCCTTAACTGTAAATTAAGGG - Intergenic
1128126350 15:65195883-65195905 TGCCCTGCCCTGTAACTTAGGGG + Exonic
1130452240 15:84067419-84067441 TAAGCTGAGATGTAAATTTGAGG - Intergenic
1131045555 15:89312017-89312039 TTCCCTGTGTTGTAAATTATTGG - Intronic
1136169491 16:28479854-28479876 CACCCTGAGTTATAAATTTGGGG + Intronic
1138392820 16:56682740-56682762 TACCCTCAACTCTAACTTAGAGG - Intronic
1141285565 16:82668475-82668497 TTCCCTGAGCTGTAGCTTTGGGG - Intronic
1153271739 18:3329427-3329449 TACCCTTGACTGCAAATTAGAGG + Intergenic
1157497016 18:48163304-48163326 TTCCCTCATCTGTAAAATAGTGG + Intronic
1157548668 18:48565615-48565637 TTCCCTGATCTGTAAAATAAGGG + Intronic
1160469872 18:79121033-79121055 TTCCCTTATCTGTAAATTAGAGG + Intronic
924987611 2:286833-286855 TTCAGTGAGGTGTAAATTAGTGG + Intronic
926462751 2:13153373-13153395 TGTCCTTAGTTGTAAATTAGTGG + Intergenic
927945676 2:27133901-27133923 CACCCTGTTCTGTAAAATAGAGG - Intronic
929536853 2:42789158-42789180 TAACCTTATCTGTAAAATAGAGG + Intronic
930343899 2:50153555-50153577 CAGCCTGAGCTATAAATTTGAGG + Intronic
931149030 2:59552002-59552024 TTCACTGACCTGGAAATTAGAGG - Intergenic
935316001 2:101834339-101834361 TACCCAGACATGTAAGTTAGTGG + Intronic
935654045 2:105406627-105406649 TACCCTGACCTGGAAATTCAAGG - Intronic
936707653 2:115094460-115094482 TACCATGTGATGTAAGTTAGAGG - Intronic
937024772 2:118689019-118689041 TTCCCTGACCTGTAAAATGGAGG + Intergenic
937135331 2:119546742-119546764 TAGCCAGAGCTGGAAATGAGTGG - Intronic
943459921 2:188159790-188159812 TACCCTCAGCATTAAATTTGAGG - Intergenic
944203580 2:197134331-197134353 AACCCTGAACTGTAAATAATTGG - Intronic
945764689 2:213960609-213960631 TAGCCTGAGGTGTAAATTTAAGG + Intronic
1171093323 20:22306686-22306708 TACCCTGAGCTGGAACAGAGGGG + Intergenic
1172621840 20:36322490-36322512 TCCCCTCATCTGTAAAGTAGGGG + Intronic
1176896010 21:14379589-14379611 TACCCAAAGCTGTAATTCAGAGG + Intronic
1177192950 21:17872004-17872026 TTCCCTGATCTGTAAAATAATGG - Intergenic
949284241 3:2382715-2382737 TAAACTGAGCTGTAAAGTACAGG + Intronic
953626187 3:44573700-44573722 TACCCTGAGCTGGACATTTCTGG + Intronic
957566522 3:81891268-81891290 TACCCTGATTTGGAAATTAGTGG - Intergenic
959216330 3:103454959-103454981 TACCCTTAGCTGAAAAGTGGTGG - Intergenic
962489740 3:135881658-135881680 TACACTGAGCTGAAAAATTGGGG - Intergenic
966780148 3:183577365-183577387 TTTCCTGAGCTATAAAATAGAGG - Intergenic
970055712 4:11969798-11969820 TTCACTGAGCTATAGATTAGTGG - Intergenic
971791993 4:31181687-31181709 TAACCTGAGATGAAAATTAATGG - Intergenic
976235198 4:82889876-82889898 CTCCCTGAGCTGTTAATTAAGGG + Intronic
978595100 4:110368988-110369010 TTTCCTGAACTGTAAAATAGGGG + Intronic
984529366 4:180897431-180897453 TACCCTGAGATGAAAACTACAGG - Intergenic
985944571 5:3167819-3167841 TACCCTTACTTGTAAAGTAGAGG - Intergenic
986074380 5:4319563-4319585 TCCCCTCACCTATAAATTAGCGG - Intergenic
987758640 5:22129751-22129773 TATTCTGAGCTGTGATTTAGTGG + Intronic
991800975 5:70363699-70363721 TATTCTGAGCTGTGATTTAGTGG + Intergenic
991827625 5:70646342-70646364 TATTCTGAGCTGTGATTTAGTGG - Intergenic
991893340 5:71363190-71363212 TATTCTGAGCTGTGATTTAGTGG + Intergenic
995011814 5:107264808-107264830 CATCCTTAGCTTTAAATTAGAGG - Intergenic
998550886 5:143077208-143077230 TACCATGAACTGTAAAAGAGTGG + Intronic
1010158204 6:72820246-72820268 CACCATCAGCTGTAAATTTGGGG + Intronic
1012099867 6:95019036-95019058 TACTCTGAGATGTAAATGAATGG - Intergenic
1014406787 6:121062694-121062716 TATCCTGAGCTGTATATCAAGGG - Intergenic
1016837856 6:148497137-148497159 CACCCTAAGCTGTAGATTAAAGG - Intronic
1020403837 7:7808295-7808317 CTCCCTGAGCTGTAAGTTACAGG - Intronic
1020518557 7:9156749-9156771 TAACCTGAGCTGTAAAGCAAAGG - Intergenic
1021052688 7:16008311-16008333 TCCCCTTTGCTGTAAATTATGGG + Intergenic
1022235937 7:28460393-28460415 TTTCCTCATCTGTAAATTAGGGG - Intronic
1028071463 7:86456232-86456254 CACCTTGAGCTGTAAAGTTGAGG - Intergenic
1031509267 7:122628037-122628059 TACAGTGTGCTATAAATTAGGGG - Intronic
1035981546 8:4378025-4378047 TACACTTACCTGTATATTAGAGG - Intronic
1044496012 8:92884115-92884137 TACTCTGAGCAGTGAATTACTGG + Exonic
1045419223 8:101997807-101997829 TACCCCCAGCTGTAGATTATTGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1045868410 8:106896590-106896612 AACCCAGAGCTGGAAATTAAGGG + Intergenic
1047723036 8:127659862-127659884 TATCCTGTGCTCTAAACTAGTGG + Intergenic
1049496004 8:142933777-142933799 CTGCCTGAGCTGTGAATTAGAGG - Intergenic
1050390671 9:5140726-5140748 TACCCTGAACTTAAAATTAAGGG - Intronic
1050726211 9:8652100-8652122 TACCCTGAGCTGTAAATTAGAGG - Intronic
1052498318 9:29257127-29257149 TATCCTAATCTGAAAATTAGGGG - Intergenic
1052554881 9:30000800-30000822 TACCCTGGGCAGCAAATCAGTGG - Intergenic
1054937378 9:70702373-70702395 TACCCTGTCCTGTAAATTGATGG - Intronic
1054939069 9:70720366-70720388 TACCCTGTCCTGTAAATTGATGG - Intronic
1055105253 9:72505448-72505470 TACCCTGTGCTTGAAACTAGAGG - Intergenic
1055658470 9:78476090-78476112 TATCCAGAGCTATAAATTATGGG + Intergenic
1185664016 X:1749957-1749979 TACCCTGAGCTGTAAAATCCAGG - Intergenic
1194409124 X:93535814-93535836 TACCCTTAGCTATAAAGTAGAGG - Intergenic
1194409129 X:93535922-93535944 TACCCTTAGCTATAAAGTAGAGG - Intergenic
1194710442 X:97230313-97230335 TATCCTTTGCTGTAGATTAGAGG + Intronic
1195124933 X:101798789-101798811 TACCCTGAACTGAAAATAAAAGG + Intergenic