ID: 1050733926

View in Genome Browser
Species Human (GRCh38)
Location 9:8741509-8741531
Sequence CTGTTTGAGTGGAAAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050733926_1050733930 6 Left 1050733926 9:8741509-8741531 CCAGCCACTTTCCACTCAAACAG 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1050733930 9:8741538-8741560 GATTCTATTATTTTAATCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050733926 Original CRISPR CTGTTTGAGTGGAAAGTGGC TGG (reversed) Intronic
902770739 1:18644074-18644096 CTGGAAGAGGGGAAAGTGGCCGG - Intronic
905035880 1:34918215-34918237 CTGTGTCAGTGGATGGTGGCAGG - Intronic
906797225 1:48707920-48707942 CTCTCTGAATGGAAAGGGGCAGG + Intronic
909001469 1:70221941-70221963 CTGCTTGAGTGGCTGGTGGCTGG + Intronic
909077024 1:71061408-71061430 CTGTTAGAGGGGAAAGTAGATGG - Intergenic
911839683 1:102664846-102664868 TGGTTAGAGTGGAAAGTGTCTGG + Intergenic
913441852 1:118906807-118906829 CTGTTTGCTGGGAATGTGGCTGG - Intronic
913488444 1:119355701-119355723 CTGTTAAACTGGCAAGTGGCTGG - Intergenic
915249182 1:154576422-154576444 CTGCTTGAGTGGACAGCAGCTGG + Exonic
916505289 1:165423066-165423088 CTTCATGAGTGGATAGTGGCAGG + Intronic
917119242 1:171631375-171631397 GTGTTTGAATGAAAAGTGGAAGG - Intergenic
919012493 1:191983260-191983282 CTGCTTCAGTGGAGGGTGGCAGG + Intergenic
920515454 1:206581776-206581798 CTGTGGGATTGGAAAGTGGAAGG + Intronic
1063541318 10:6937275-6937297 CTGTTTAAATAGAAAGTGCCTGG - Intergenic
1072153266 10:92700378-92700400 CTGTTTGAGGGAAATGTTGCTGG + Intergenic
1072627058 10:97119323-97119345 CTCTTTTAATGGAAAGGGGCGGG + Intronic
1073146072 10:101282742-101282764 CTGCTAGGGTGGAAAGAGGCAGG + Intergenic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG + Intronic
1075642170 10:124072634-124072656 ATCTTTGAGATGAAAGTGGCTGG - Intronic
1075856133 10:125631751-125631773 CTATATGTGTGGGAAGTGGCAGG + Intronic
1076430102 10:130395734-130395756 CTGCTTAAGTGCAAAGTAGCTGG + Intergenic
1076856925 10:133121346-133121368 CTGTGTGTGTGGAATGTGCCAGG + Intronic
1080164022 11:29215165-29215187 CTTATTGAGTATAAAGTGGCAGG - Intergenic
1080843727 11:36007793-36007815 CTTTCTGAGGGGAAACTGGCAGG + Intronic
1080967355 11:37228588-37228610 CTGTTTCAGAGGCAAGTGACAGG - Intergenic
1081713556 11:45233292-45233314 GTGTTGGAGAGGAGAGTGGCTGG + Intronic
1084751668 11:71208235-71208257 CTGGTTGAGTGGGATGTGCCAGG + Intronic
1087247096 11:95852154-95852176 GTGTTTGGGTGTAAAGAGGCTGG - Intronic
1088678799 11:112221893-112221915 CTGTTTTAGTGGAGAGAGGCAGG + Intronic
1089323489 11:117642020-117642042 CTGTTGGAGTGGGGAGAGGCAGG - Intronic
1090953519 11:131495236-131495258 TTCTTTGAATGGCAAGTGGCAGG - Intronic
1091136264 11:133193156-133193178 CTATCTGACTGGAAAGAGGCAGG - Intronic
1091631646 12:2165661-2165683 CTGTTTAAGTGGAAAATGCATGG + Intronic
1092908463 12:13123799-13123821 CTGTAAGAGTGGAAATTGGTTGG + Intronic
1097935532 12:65245450-65245472 CTCTTTTACTGGAAAGTGGGAGG + Intronic
1100089586 12:90954198-90954220 CTGTATGAGTGGAGAGAGCCTGG - Exonic
1101083091 12:101208995-101209017 CTGTTTCAGTGGAAAGGGGGTGG + Intronic
1102897195 12:116607896-116607918 CTGTGTGACTGCACAGTGGCAGG + Intergenic
1103190942 12:119001503-119001525 CTGTATGAGTGGAAGAGGGCAGG + Intronic
1103528399 12:121582612-121582634 CTGTCAGAGTGGGAAGGGGCTGG + Intergenic
1106555793 13:30807451-30807473 GTGTTAAGGTGGAAAGTGGCTGG + Intergenic
1106880502 13:34123735-34123757 CTGTTTTAGTGAACAGTGCCCGG + Intergenic
1108003544 13:45925839-45925861 CTGTGTGTGTGGTAAGGGGCTGG + Intergenic
1108507462 13:51125462-51125484 CCCTTTGAGTGGAAAATGGCTGG + Intergenic
1108570369 13:51743766-51743788 CAGTTTTACTGGAAAGTGGGAGG + Intronic
1109386007 13:61629578-61629600 CTGTTTGAGGGAAATGTTGCAGG - Intergenic
1109548242 13:63858189-63858211 GTGTTTGTGTGGAAAATGGGTGG - Intergenic
1111900723 13:94196610-94196632 CTGTTTGAGTTGAAACTAACAGG + Intronic
1112709911 13:102115674-102115696 CTGCTTGAGTGGAGAGGGTCAGG + Intronic
1114779822 14:25525957-25525979 CTGTTTGATTGTGAAGTGACTGG + Intergenic
1115271390 14:31557375-31557397 CTGATTGAGTGGAACGTAGTTGG - Intronic
1117157176 14:52951863-52951885 CTGTTTGACTGGCATCTGGCTGG - Intronic
1117430981 14:55660945-55660967 CTGTTATAGTTGAGAGTGGCTGG - Intronic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1128496073 15:68199439-68199461 CAGTTTGAGGGGCAGGTGGCAGG - Intronic
1129169076 15:73796975-73796997 CTGTTTGTCTGGAACTTGGCTGG - Intergenic
1129681316 15:77659929-77659951 CTGGTGGAGAGGAAAGGGGCGGG + Intronic
1134462589 16:14442398-14442420 CTGCTTGGATGGAAAGTGGCTGG + Intronic
1138599827 16:58047730-58047752 CTCTTTGTGTTGAAACTGGCTGG + Intergenic
1138907957 16:61360958-61360980 CTGTTGGAGTGGAAGGTCACAGG + Intergenic
1139229542 16:65270325-65270347 CTGTATGGGTGGAAAATGGAAGG - Intergenic
1142288923 16:89183846-89183868 ATGTTGGAATGGGAAGTGGCAGG - Intronic
1142475601 17:187258-187280 CTGTGGGATTGGAAAGAGGCCGG + Intergenic
1142642576 17:1292989-1293011 ATCTTTGAGAGGAAAGAGGCCGG + Intronic
1144664931 17:17095909-17095931 AACTTTGAGTGGGAAGTGGCTGG - Intronic
1145067350 17:19770747-19770769 TTGTTTCAGTGGGAAGTGGGAGG - Intergenic
1146448135 17:32949609-32949631 CTATTTGATTGGAAAATGGGAGG - Intergenic
1148079631 17:44960511-44960533 CTGTATGATTGGAAGGGGGCGGG - Intronic
1148460954 17:47838720-47838742 CTGTGGGAGGGGAGAGTGGCTGG + Intronic
1149324832 17:55519359-55519381 GTGTGTGGGTGGAATGTGGCGGG + Intergenic
1150227475 17:63531761-63531783 CTGTTAGACTGGAGAGTGGTCGG + Intronic
1152821576 17:82440202-82440224 CTGTGTGTGTGGAAACTCGCAGG + Intronic
1153047946 18:873595-873617 GTGTTTGTGTGGAAAGAGGTAGG + Intergenic
1155392281 18:25350167-25350189 CTGTTGGAGAGGGAAGTTGCGGG - Intronic
1156719998 18:40058420-40058442 CTGAATGAGTGATAAGTGGCTGG - Intergenic
1160857453 19:1223934-1223956 CTGTTTCAGCGGGAAGTGGTGGG + Intronic
1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG + Intronic
1162499338 19:11042581-11042603 CTGTTGGAGGGGAAAGTGAAGGG + Intronic
1163993242 19:21018969-21018991 CTGAGTGACTGGAATGTGGCTGG + Intergenic
1164513406 19:28915111-28915133 CTCTTTAAGAAGAAAGTGGCAGG - Intergenic
1165320087 19:35079883-35079905 CTGTGTGAGTGCAAGGAGGCTGG + Intergenic
927553137 2:24016183-24016205 CTGTTTGGGGGAAAAGTGTCTGG + Exonic
928366622 2:30707826-30707848 ATGTTTGCTTGGAAAGTGCCTGG - Intergenic
930050146 2:47208979-47209001 CTGTTTGAGTGGAGAATGGAAGG - Intergenic
931179260 2:59883399-59883421 CTGTTTGAAAACAAAGTGGCAGG - Intergenic
932452841 2:71826571-71826593 CTGTTCCCCTGGAAAGTGGCAGG - Intergenic
933807892 2:86013208-86013230 CTGTTCTAGGGGACAGTGGCAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935248781 2:101242905-101242927 CCTTTTAAGTGGAAAGGGGCAGG + Intronic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
941423367 2:165312144-165312166 CTGGATGAGTGGGAGGTGGCAGG - Intronic
944221971 2:197311341-197311363 GTGTTTAGCTGGAAAGTGGCTGG - Intergenic
946400765 2:219467248-219467270 CTGTTTGAGTGCCTGGTGGCGGG + Exonic
946758992 2:222974574-222974596 CAGTTTAAGTGGAAAGTGTCAGG + Intergenic
947863850 2:233382282-233382304 ATGTTTCAGTGGAAAGAAGCTGG - Intronic
948573350 2:238932025-238932047 CTGTTTGATTGCACTGTGGCTGG - Intergenic
1168859353 20:1034826-1034848 CAGTTTCATTGGGAAGTGGCAGG + Intergenic
1169921045 20:10734498-10734520 CTCTTTGAGTAGCAAATGGCTGG + Intergenic
1171044091 20:21794180-21794202 CAGTTTGAGTGCACAGGGGCTGG - Intergenic
1172200858 20:33125123-33125145 CCTTTTGCCTGGAAAGTGGCTGG - Intergenic
1172328653 20:34058076-34058098 CTTTTTGAGGGGAAGGGGGCCGG + Intronic
1173268652 20:41511097-41511119 GTGTTTGCATGGAAAGTAGCAGG - Intronic
1174590647 20:51641969-51641991 CTTTATGAGAGGAAAGTGGGAGG + Intronic
1179236696 21:39553822-39553844 CTGTTTAAGTGGGAGGTGGTTGG + Intergenic
1179489727 21:41733528-41733550 CTGATGGAGTGGAGAGTGGGAGG + Intergenic
1182321704 22:29481934-29481956 CTTTTTGAGTTGAAAGAGGAGGG + Intronic
1183507883 22:38219646-38219668 CTGTTTGCGTGGAGGGTGGGGGG - Exonic
1184406734 22:44304737-44304759 CTGTGGGAGTGGAGAGTGACGGG + Intronic
950627715 3:14260402-14260424 AGGTTTGAGTAGAAATTGGCAGG + Intergenic
951149172 3:19266992-19267014 CTGTTTGTATGGGAAGTGACCGG + Intronic
952335260 3:32398484-32398506 CTATTTGAGTATAAAGAGGCAGG - Intronic
953149737 3:40314014-40314036 CTGTGTGAGTCCAAAGTGGGTGG + Intergenic
954698971 3:52441868-52441890 CTGGCAGTGTGGAAAGTGGCCGG - Exonic
955468520 3:59261740-59261762 GTGTTTGAATGGACAGTGGAGGG + Intergenic
955615611 3:60803749-60803771 CTCTTTGAGGGGAAAATGGCAGG - Intronic
956260495 3:67335550-67335572 CATTTTGAGTGGAAAATGGAGGG + Intergenic
958537345 3:95420728-95420750 ATGTTTGAATTGAGAGTGGCAGG - Intergenic
960698803 3:120420868-120420890 GTGGTTTAGTGGAAAGAGGCTGG - Intronic
962748303 3:138414091-138414113 CTGTTTGAGTAAATGGTGGCTGG - Intergenic
964082891 3:152782122-152782144 CTGTTGGCTTGGCAAGTGGCTGG + Intergenic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981342342 4:143635947-143635969 CTGTGTGAGTGAACAGTGTCAGG - Intronic
982740788 4:159054821-159054843 CTATGTGAGTGGCAAGGGGCAGG - Intergenic
986275345 5:6270387-6270409 CTGTTTGAATCTAAAGGGGCTGG + Intergenic
986602069 5:9482460-9482482 CTGGGTGAGTGGAAGGTGGGAGG + Intronic
988774268 5:34463109-34463131 CCTTTTAAGTGGAAAGGGGCAGG - Intergenic
989789919 5:45385936-45385958 CTGTTTTAGTGGTATCTGGCAGG - Intronic
990727540 5:58773503-58773525 GTGTTTGTGTGGAAAGTAGGTGG + Intronic
991389184 5:66124080-66124102 CTATTTGAGTAGATAATGGCTGG + Intergenic
992762465 5:79962670-79962692 CTGCTTGAATGGGAGGTGGCGGG - Intergenic
994135804 5:96284547-96284569 GTGTTGGAGTGGAAAGAGCCTGG + Intergenic
994331258 5:98509114-98509136 CTGTTGAAGTGGTAAGGGGCAGG + Intergenic
995632089 5:114145125-114145147 CCTTTTAAGTGGAAAGGGGCAGG - Intergenic
996010475 5:118477004-118477026 TTTTTAGAGGGGAAAGTGGCTGG + Intergenic
998328501 5:141303576-141303598 CAGTTTGTCAGGAAAGTGGCTGG - Exonic
999878224 5:155832216-155832238 CTTTATGAGTGGCGAGTGGCAGG + Intergenic
1004847221 6:19658259-19658281 CTGCTTCAGTGGAGAATGGCAGG - Intergenic
1005507331 6:26481222-26481244 CAGTTTGTGTGGAAGGGGGCAGG - Intergenic
1005822711 6:29610811-29610833 CTGTTAGGTTGGAATGTGGCTGG - Intronic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006505882 6:34488298-34488320 CTGTTTGTATGGCAAGGGGCAGG - Intronic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006885215 6:37375972-37375994 CTGCAGGAGTGGGAAGTGGCAGG + Intronic
1007195155 6:40054260-40054282 CTGTTAGAGTAGAAATGGGCAGG - Intergenic
1007694039 6:43720274-43720296 CTGCTTGAGTGGAAAGAGGATGG + Intergenic
1007712488 6:43833612-43833634 CAGTTTAATTGGGAAGTGGCGGG + Intergenic
1007740288 6:44005581-44005603 GTTTTGGAGTGGAAAGGGGCAGG - Exonic
1008272214 6:49503436-49503458 CCTTTTAAGTGGAAAGGGGCAGG - Intronic
1008943062 6:57068459-57068481 CATTTTGATTTGAAAGTGGCAGG + Intergenic
1011315732 6:86028605-86028627 CTCTCAGAGTGGAGAGTGGCAGG + Intergenic
1014663002 6:124197316-124197338 CTGGTGGGGTGGAAAGTGGGAGG - Intronic
1015424306 6:133047991-133048013 ATGTTTGAGGGGAAAGACGCTGG + Intergenic
1017557728 6:155590170-155590192 CTGTTAGAATGGAAAATGGATGG - Intergenic
1017720878 6:157242317-157242339 ATGTTTAACTGGAAAGCGGCTGG - Intergenic
1020067674 7:5201445-5201467 CTTTTAGAGTGGATATTGGCCGG + Intronic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1021715184 7:23455285-23455307 CTGTTTGAGATTAAAGAGGCTGG - Intronic
1022349168 7:29550686-29550708 CCCTATGAGTGGAAACTGGCAGG + Intergenic
1022498182 7:30866219-30866241 CTGGGTGAGTGGATAGGGGCAGG - Intronic
1022539178 7:31120787-31120809 CTGGCTGAGAGGAAGGTGGCTGG + Intergenic
1023088740 7:36598233-36598255 CAGCTGGAGTGGACAGTGGCTGG + Intronic
1024777349 7:52803105-52803127 GTGGTTGAGTGGAGAATGGCAGG - Intergenic
1026190000 7:68117076-68117098 CTGTTTGAGGAGTGAGTGGCGGG - Intergenic
1027484401 7:78742466-78742488 CTGTTTTGTTAGAAAGTGGCAGG + Intronic
1027654929 7:80919046-80919068 CGGAGTGAATGGAAAGTGGCCGG + Exonic
1030087492 7:105829485-105829507 CTCTCTGAGTGGGAAATGGCTGG - Intronic
1030950690 7:115787680-115787702 GTGTTTGAATGGAAAGAGGGTGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033713727 7:143977539-143977561 CTATTTTTGTGGAAAGTGGTGGG - Intergenic
1037053684 8:14408677-14408699 CTAGATGAGGGGAAAGTGGCAGG - Intronic
1038043312 8:23745310-23745332 AAGTTTGAGTGGTATGTGGCAGG - Intergenic
1038383593 8:27119902-27119924 CTTTCTGTGTGGCAAGTGGCAGG + Intergenic
1040713751 8:50222076-50222098 GTGGTTGAGTGGAGAGTTGCAGG + Intronic
1042472121 8:69202485-69202507 CAGCTTCAGTGGAAAGTGTCAGG + Intergenic
1043543238 8:81286738-81286760 ATGTTTGAGAGGACAGTGGCAGG - Intergenic
1045303517 8:100936076-100936098 TGGTTTGAGTGTATAGTGGCAGG - Intronic
1045734132 8:105275392-105275414 ATGTAGGAGTGGAAAGTGGGTGG - Intronic
1048313355 8:133343400-133343422 CTGATTGAGTAGATAGAGGCTGG + Intergenic
1048599168 8:135900706-135900728 CTAGTAGATTGGAAAGTGGCTGG + Intergenic
1048643800 8:136394913-136394935 CTGTTTCAGTGGGATGTGGGTGG + Intergenic
1050733926 9:8741509-8741531 CTGTTTGAGTGGAAAGTGGCTGG - Intronic
1050825400 9:9939240-9939262 CTGTATGAATGGAATGTGCCAGG + Intronic
1052492653 9:29188838-29188860 CTGTCTGGGAGGAAGGTGGCGGG - Intergenic
1054950360 9:70844099-70844121 CTGTTTGAGAGGGAAGTTGGAGG + Intronic
1056186876 9:84143587-84143609 CTGTGTGTGTGGGAAATGGCAGG + Intergenic
1057014037 9:91634783-91634805 TTGTTTGAGTGGAAACTGTAGGG + Intronic
1057099371 9:92343439-92343461 GAGTTTGTGGGGAAAGTGGCAGG + Intronic
1059646705 9:116275313-116275335 GTGTTTGTGTGGAATGTTGCGGG + Intronic
1188679331 X:32982539-32982561 CTGTTTTAGTGGGAAGAGGAAGG - Intronic
1190780667 X:53591922-53591944 CTCTTTGAGATGGAAGTGGCAGG + Intronic
1190992291 X:55565150-55565172 CTGCTTGACTGGAGAGTGGAGGG - Intergenic
1191576263 X:62709761-62709783 CTTTTTAAGTGGAAAGGGGCAGG - Intergenic
1192098675 X:68240105-68240127 CTGTTAGAATGAAAATTGGCCGG - Intronic
1194413194 X:93579752-93579774 GTGTCTGACTGGACAGTGGCTGG + Intergenic
1196002028 X:110796163-110796185 CTGTGTGATGGGAAAGTAGCCGG - Intergenic
1196207925 X:112962183-112962205 CAGTTTGAGTGGAATGTTGGGGG + Intergenic
1197401184 X:125992792-125992814 GTGTGTGAGTGGGAAGAGGCAGG - Intergenic
1198832503 X:140765239-140765261 CTGGTTGTGTGGGAAGGGGCAGG + Intergenic