ID: 1050735871

View in Genome Browser
Species Human (GRCh38)
Location 9:8762614-8762636
Sequence CAGGCCATTAATTTTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 261}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050735871_1050735873 0 Left 1050735871 9:8762614-8762636 CCTCTTTTAAAATTAATGGCCTG 0: 1
1: 0
2: 3
3: 22
4: 261
Right 1050735873 9:8762637-8762659 CTGCAGCATGATGAGTGCTCAGG No data
1050735871_1050735875 18 Left 1050735871 9:8762614-8762636 CCTCTTTTAAAATTAATGGCCTG 0: 1
1: 0
2: 3
3: 22
4: 261
Right 1050735875 9:8762655-8762677 TCAGGAAAAGAAATATTTATGGG No data
1050735871_1050735874 17 Left 1050735871 9:8762614-8762636 CCTCTTTTAAAATTAATGGCCTG 0: 1
1: 0
2: 3
3: 22
4: 261
Right 1050735874 9:8762654-8762676 CTCAGGAAAAGAAATATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050735871 Original CRISPR CAGGCCATTAATTTTAAAAG AGG (reversed) Intronic
900742750 1:4340579-4340601 GAGGCCATTAACTTTCAAACTGG + Intergenic
901762024 1:11478060-11478082 CCAGCCCTTATTTTTAAAAGAGG - Intergenic
905683644 1:39892940-39892962 CAGAATATTAACTTTAAAAGGGG - Intergenic
908487540 1:64610246-64610268 CAGGACATTAGTTTTGAGAGGGG - Intronic
909257717 1:73446167-73446189 CAGATCATTAATTTCAAGAGAGG - Intergenic
909585666 1:77284837-77284859 AAGGGCATTGATTTTAAAATGGG - Intronic
909735750 1:78959444-78959466 CAGGCCAATAGTTTTTAAACCGG + Intronic
910836999 1:91524236-91524258 CAGGGAATTCATTTAAAAAGGGG + Exonic
913115623 1:115693835-115693857 TAGGCTATTCTTTTTAAAAGGGG + Exonic
917575833 1:176320989-176321011 CAGCCCCTTATTTTAAAAAGTGG + Intergenic
918201916 1:182275714-182275736 CAGGGCATTAAGTTAAAATGTGG + Intergenic
918440215 1:184559423-184559445 CAGGTAATTTATTTAAAAAGTGG - Intronic
918499454 1:185177800-185177822 TAGGACATTAATTTTCAATGAGG - Intronic
918826763 1:189335311-189335333 AAGGGAATTAATTTTAAAAGAGG - Intergenic
919243231 1:194941725-194941747 GAGGCAATTAATGTTAAATGAGG - Intergenic
919999100 1:202782498-202782520 CAAGCCATGACTTTTAAATGGGG + Intronic
920906225 1:210172387-210172409 GAGACCATTTATTTTAAAATTGG - Intergenic
921708822 1:218353107-218353129 CATGCCATTGATTTTAAGAGAGG + Intronic
921709230 1:218356862-218356884 CAGGCAATTCATTTTAAAGGCGG + Intronic
921836239 1:219781860-219781882 CAGGCAACAAATTTTAAAAAAGG - Intronic
922243728 1:223774776-223774798 ATAGCCTTTAATTTTAAAAGTGG + Intronic
923616334 1:235541205-235541227 CAGGCTATTAAGATTAGAAGCGG + Intergenic
923822558 1:237461410-237461432 CAGGCCCTTCTTCTTAAAAGAGG - Intronic
1063704326 10:8416179-8416201 CAGGCAATTAAATTTGAGAGAGG - Intergenic
1065056271 10:21845637-21845659 TAGGACATTAATTTTTAAACTGG + Intronic
1066022076 10:31313748-31313770 CAGTTCTATAATTTTAAAAGAGG + Intergenic
1066500607 10:35990654-35990676 GAGGATATTACTTTTAAAAGAGG - Intergenic
1067417188 10:46111660-46111682 CGGGCTCTTAATTTTTAAAGAGG + Intergenic
1067445387 10:46339262-46339284 CGGGCTCTTAATTTTTAAAGAGG + Intergenic
1067502603 10:46818554-46818576 CGGGCTCTTAATTTTTAAAGAGG + Intergenic
1067874379 10:49990755-49990777 CGGGCTCTTAATTTTTAAAGAGG + Intronic
1068145690 10:53067666-53067688 CAGGTTATTCATTATAAAAGTGG + Intergenic
1068590432 10:58847527-58847549 CTGGCCTTTAATTCTATAAGAGG + Intergenic
1069493040 10:68877886-68877908 GAGGCCCTTAATTTTAAAAGAGG - Intronic
1071205255 10:83268015-83268037 CAGTCCATACATTTTAAATGGGG + Intergenic
1075942287 10:126401139-126401161 CAAGCCATTATTTTGAAAATGGG + Intergenic
1077621847 11:3732040-3732062 CAGACAAATAATTTTAAATGGGG - Intronic
1078197893 11:9151828-9151850 CAGGCCCTTTATTTTACAAGAGG - Intronic
1078935677 11:15948128-15948150 TAGGCCATTGATTGTAATAGCGG - Intergenic
1080275215 11:30496159-30496181 CATACCATAAATATTAAAAGAGG - Intronic
1080282844 11:30578426-30578448 CAAGCCATTTTTTTCAAAAGAGG + Intronic
1080987150 11:37482501-37482523 CTAGGCTTTAATTTTAAAAGAGG - Intergenic
1081287311 11:41286746-41286768 CAGGCTAATAATTATGAAAGAGG + Intronic
1081297794 11:41412816-41412838 CAGGCCACTAATTCTCAAAAAGG + Intronic
1081458541 11:43249390-43249412 AAAGCCATTAATTTTTAAAGTGG - Intergenic
1083029786 11:59581984-59582006 AAGGCCCTTAATTGTAAAAATGG + Intronic
1084288726 11:68148134-68148156 CAGTCCAGAAAGTTTAAAAGGGG - Intergenic
1084454110 11:69257553-69257575 GAGGCAATTAAGTTTAAATGAGG + Intergenic
1086036368 11:82420160-82420182 CAATCCATTAATTTCTAAAGTGG - Intergenic
1086234043 11:84606207-84606229 CAGGATTTTAATTTTAACAGTGG + Intronic
1086504551 11:87491271-87491293 CAGGGCATTTACTTTAAAATGGG + Intergenic
1086907884 11:92437979-92438001 AAGGCCCTTGTTTTTAAAAGTGG + Intronic
1086943312 11:92820388-92820410 GAGGCAATTAATGTTAAATGAGG - Intronic
1087354963 11:97081181-97081203 CAGGACATCAATGTTAAAATAGG - Intergenic
1087813739 11:102635757-102635779 TTGGCCAGTTATTTTAAAAGAGG + Intergenic
1088032836 11:105273025-105273047 GAGGGCACTAATTTTCAAAGAGG + Intergenic
1092800177 12:12156971-12156993 CAGGCAATACATTTTAAAAATGG - Intronic
1094213015 12:27912164-27912186 TGTGCCTTTAATTTTAAAAGTGG - Intergenic
1095530254 12:43178810-43178832 CACGCCCTTTATTTTAAAAAAGG - Intergenic
1095745338 12:45652211-45652233 CAGGTCAATAATTTTAGAGGAGG + Intergenic
1095862249 12:46930512-46930534 CAGTCCATTAATGTTGAAAGTGG - Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098198747 12:68032050-68032072 CAGCGAAATAATTTTAAAAGAGG - Intergenic
1098753945 12:74333546-74333568 CAGGTGTTTATTTTTAAAAGTGG + Intergenic
1098982154 12:76968242-76968264 CAGCCCATTATCTTTCAAAGAGG + Intergenic
1099746809 12:86715095-86715117 TAGCCCTTTACTTTTAAAAGTGG + Intronic
1102428701 12:112864731-112864753 CAGGACATTCATTTTCAAAGGGG + Intronic
1103326767 12:120126713-120126735 CAGGCCAGTAATTTTGACAGAGG + Intergenic
1103623433 12:122202332-122202354 CAGGCCCATAATTGGAAAAGAGG + Intronic
1104222474 12:126798288-126798310 CAGGCCAGGAAATTTAAATGTGG - Intergenic
1105662852 13:22517882-22517904 CATGCCATGTATTTTAAGAGAGG - Intergenic
1106903140 13:34376194-34376216 CAGGCCTTTATTTTTATCAGAGG + Intergenic
1107129310 13:36878575-36878597 CAGGCAGTTATTTTTAAAAATGG - Intronic
1107917722 13:45169233-45169255 GAGGCGATGAATTTAAAAAGAGG + Intronic
1108732370 13:53248172-53248194 AAGGCCTTGAATTTTAAAAAGGG - Intergenic
1108779113 13:53806272-53806294 AAGGCCATTCATCTTGAAAGGGG + Intergenic
1109885036 13:68531232-68531254 GATGTCATTAATTTTAATAGTGG + Intergenic
1110908184 13:80919107-80919129 CATACCATTAGTTTTAAAACAGG + Intergenic
1111063333 13:83053790-83053812 GAGGCAATTAAGTTTAAATGAGG - Intergenic
1111787122 13:92802817-92802839 AAAGCTATTAATTTTGAAAGTGG - Intronic
1111875350 13:93886666-93886688 CTGTCCATCAATGTTAAAAGAGG - Intronic
1112443304 13:99441276-99441298 CAATCCATTGATTTTAAATGTGG + Intergenic
1112820075 13:103322910-103322932 AAGACAAATAATTTTAAAAGGGG - Intergenic
1113273658 13:108703896-108703918 GAGGCCAATAAGTTAAAAAGAGG + Intronic
1117360173 14:54965106-54965128 CAGACTTTTAATTTTAAAATTGG - Intronic
1117580508 14:57146716-57146738 CAAGCTATTAATTTATAAAGAGG + Intergenic
1118031977 14:61826876-61826898 CAAGCCAGGAATATTAAAAGGGG - Intergenic
1119619657 14:76122701-76122723 CAAGCCTTTGATTTTAAAAATGG - Intergenic
1121108420 14:91295843-91295865 GAGGCCATTAAGTTAAAATGAGG + Intronic
1124291875 15:28459176-28459198 CAAGCCATGAATTTTAACACTGG + Intergenic
1125353599 15:38792965-38792987 CAGGCCAATAATCTAAGAAGTGG - Intergenic
1127815657 15:62606718-62606740 AAGGCCATTGATTTTGAAATTGG + Intronic
1127869148 15:63056078-63056100 GAGGCCAGTTATTCTAAAAGGGG + Intronic
1128284614 15:66426223-66426245 CAGCCCAGTAATCTTAAAATAGG + Intronic
1128953827 15:71918120-71918142 AATGCCATTTCTTTTAAAAGAGG + Intronic
1131674301 15:94655326-94655348 GGGGCCATTTGTTTTAAAAGTGG + Intergenic
1133494946 16:6309108-6309130 CAGGCCATTGAATTCAAAACAGG - Intronic
1134400274 16:13903533-13903555 TAGGTAATTAATTTTAAATGAGG + Intergenic
1135697815 16:24605485-24605507 CAGGTTATTAATTTAAAAAAAGG - Intergenic
1135831997 16:25782755-25782777 AATCTCATTAATTTTAAAAGAGG - Intronic
1137295554 16:47089395-47089417 CATCCCCTTCATTTTAAAAGAGG - Intronic
1138408428 16:56818287-56818309 GAGGCCATTATTTTTATCAGTGG - Intronic
1138874298 16:60930471-60930493 CACACCATGCATTTTAAAAGAGG + Intergenic
1143124858 17:4635589-4635611 CTGGCCATGCATTTTCAAAGGGG - Intronic
1144196469 17:12899927-12899949 CAGGGCAAAACTTTTAAAAGTGG - Intronic
1146528124 17:33584432-33584454 GAGGCTTTTAATTTTAAAACTGG + Intronic
1146680646 17:34805302-34805324 CAGGGCATTAAAATAAAAAGGGG + Intergenic
1148532922 17:48412144-48412166 AAGCCTATTAATTTAAAAAGTGG + Intronic
1150978412 17:70114751-70114773 CCCGCCATTAATTATAAAATTGG - Intronic
1152167546 17:78720250-78720272 CAGGCCTTTATTTTTAATGGTGG - Intronic
1154372392 18:13775880-13775902 TGGGCAATTTATTTTAAAAGAGG + Intergenic
1155217807 18:23658725-23658747 GAGTCAATTAAGTTTAAAAGAGG + Intronic
1155373631 18:25132600-25132622 TAGGCTTTTAAATTTAAAAGAGG - Intronic
1155827972 18:30472813-30472835 CAAGACATTAATTCTAAAAAAGG - Intergenic
1157213510 18:45763450-45763472 CAGGACATTAATTTTAATTAGGG - Intergenic
1157586846 18:48806501-48806523 TAGGCCATTCATTTTCCAAGAGG + Intronic
1158839538 18:61369481-61369503 TAGGCAATGTATTTTAAAAGAGG + Intronic
1159105449 18:63998634-63998656 TTTGCCAATAATTTTAAAAGAGG - Intronic
1159351473 18:67280585-67280607 CAGGAAATAAACTTTAAAAGTGG - Intergenic
1159814585 18:73057365-73057387 CAGGTCATTAATGTGAAATGAGG + Intergenic
1162815158 19:13189684-13189706 CAGGCTAGAAATTTTAAATGTGG + Intergenic
1165099315 19:33429092-33429114 CAGGCCATGGCTTTTAAGAGTGG + Intronic
925109514 2:1321980-1322002 AAGGTTATTAATTTTAAAAATGG - Intronic
927654500 2:24933915-24933937 CAGGACAGTGATTTTCAAAGTGG - Intergenic
928562250 2:32501847-32501869 CAGGCCATGTATGTTAAAATTGG - Exonic
929560492 2:42953436-42953458 GAGGCAATTAAATTTAAGAGAGG + Intergenic
930352828 2:50279108-50279130 CAGGCCAATGATTTGAAGAGTGG - Intronic
931217922 2:60263654-60263676 CTGGATATAAATTTTAAAAGAGG + Intergenic
931386354 2:61801194-61801216 CAATCCAGTAATTTTTAAAGTGG - Intergenic
931539259 2:63311270-63311292 CAAGCTTTTAATTTCAAAAGAGG + Intronic
931828931 2:66030484-66030506 GAGGCGATTAATTTAAAAAGTGG - Intergenic
932860147 2:75283003-75283025 CAACTCATTATTTTTAAAAGCGG + Intergenic
933156907 2:78986081-78986103 CAAAACATTTATTTTAAAAGAGG + Intergenic
934874101 2:97898436-97898458 CAGGCAATTAAGGTTAAATGAGG + Intronic
941078596 2:161034291-161034313 GTGGAGATTAATTTTAAAAGCGG + Intergenic
941515430 2:166469436-166469458 AAGCACATTTATTTTAAAAGAGG + Intronic
943140994 2:183980986-183981008 CAGGGAATTAAATTTGAAAGAGG + Intergenic
944214515 2:197240838-197240860 CAGACAATTACTTTTAAGAGAGG - Intronic
944734245 2:202547387-202547409 CAGGCAAGTGATTTTAACAGGGG - Intronic
945039555 2:205732698-205732720 CAGGCCTATGATTTTAAAAGAGG - Intronic
945647485 2:212517209-212517231 CAGGCCATGAATTGTAAACATGG - Intronic
1169713261 20:8588495-8588517 GAGGTCATTAATGTTAAATGAGG + Intronic
1170153732 20:13250979-13251001 CAGGTCATGAATATTAAAAGTGG - Intronic
1170967979 20:21093281-21093303 CTGGCCATTTAATTAAAAAGTGG + Intergenic
1171313049 20:24161236-24161258 CAGGCCATTTACTTGATAAGTGG - Intergenic
1173382598 20:42559529-42559551 CATGCCATTACTATTAAAGGAGG + Intronic
1174987765 20:55474631-55474653 CAGGCCATAGATTTTAAATCTGG - Intergenic
1175706527 20:61182423-61182445 CAGCCCATGAATTTAAAATGAGG + Intergenic
1178405587 21:32320704-32320726 CATACCATTAATTTTTAAAACGG - Intronic
1179446890 21:41438325-41438347 CAAGCCATTAGTTTTAAGATGGG - Intronic
1181869909 22:25889826-25889848 CATGTAATTAATTTTAAAATAGG - Intronic
954588785 3:51762319-51762341 CAATCCATTAATTCTGAAAGAGG - Intergenic
954930497 3:54276990-54277012 CAGGCCCTGAATTTGAAAACTGG - Intronic
955902017 3:63766598-63766620 CTGGCCATTCATTTGAAATGTGG + Intergenic
956318913 3:67973096-67973118 CAAGCAATTAATTTTTAAAAAGG + Intergenic
956884980 3:73550154-73550176 CAGGCCAGTGGTTTTCAAAGTGG + Intronic
958158105 3:89781670-89781692 GAGGTCATTAATTTTAAAGGAGG - Intergenic
960234461 3:115265709-115265731 TTAGCCCTTAATTTTAAAAGTGG - Intergenic
961383413 3:126510344-126510366 CAAGCCATGGTTTTTAAAAGGGG + Intronic
962509257 3:136082538-136082560 CAGGCCAATAATTTTTAAGAGGG + Intronic
963310811 3:143708232-143708254 CAGCCCATTCAGTTTGAAAGGGG + Intronic
966147399 3:176827253-176827275 CTGCCCCTGAATTTTAAAAGAGG + Intergenic
966355759 3:179076970-179076992 CAGAATATAAATTTTAAAAGTGG - Intergenic
966662881 3:182434228-182434250 CAGACCTTTATTGTTAAAAGAGG - Intergenic
969934484 4:10667277-10667299 AAGGAGATTAATTTTAAAACTGG + Intronic
970411854 4:15816652-15816674 CATGCCATTGATTTTAAAACTGG + Intronic
970516452 4:16835669-16835691 CAGGCAAAGAGTTTTAAAAGTGG + Intronic
970762675 4:19510193-19510215 GCGCCTATTAATTTTAAAAGGGG + Intergenic
971088265 4:23305891-23305913 CAGGGCAGTACTTTTCAAAGAGG - Intergenic
971493927 4:27243887-27243909 CAGGCTCTTGATTTTAAAAGGGG + Intergenic
972034334 4:34502420-34502442 CAGGAAAATAATTTTTAAAGGGG - Intergenic
973868420 4:55138890-55138912 CCGGCCAAGAATTTTAAAGGTGG - Intergenic
974449822 4:62039707-62039729 AAAGGCATTAATTATAAAAGGGG - Intronic
975030673 4:69611067-69611089 TAGGCAAATAATTTTAAAATAGG + Intronic
975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG + Intronic
975998089 4:80339814-80339836 CAGGCCCTTTATTTTAATAAAGG + Intronic
976509297 4:85889746-85889768 CAGGGCATTATTTATAGAAGAGG - Intronic
978074458 4:104511879-104511901 CAGCCCATTAATTAGCAAAGAGG - Intergenic
980050098 4:128030915-128030937 CTGGCCATTAATATTTGAAGAGG - Exonic
980679613 4:136140751-136140773 TATGGCATTATTTTTAAAAGTGG - Intergenic
981363981 4:143879999-143880021 TATCCCATTAATTTTAAAATGGG - Intronic
981374706 4:144000773-144000795 TATCCCATTAATTTTAAAATGGG - Intronic
981385038 4:144120079-144120101 TATCCCATTAATTTTAAAATGGG - Intronic
981883250 4:149641400-149641422 TAGGACATTAATTTTTAAAATGG - Intergenic
982806884 4:159777161-159777183 GATGCTATTAATTTTGAAAGTGG - Intergenic
983107713 4:163710199-163710221 AAGGCCAATACTTTGAAAAGTGG + Intronic
983522201 4:168721283-168721305 GAGACCTTTTATTTTAAAAGGGG + Intronic
984654272 4:182300354-182300376 CAGGCCATACAGTTGAAAAGGGG + Intronic
984679386 4:182590053-182590075 CAAGAAATTAATATTAAAAGTGG - Intronic
988371717 5:30378035-30378057 CAGGTCATTAAATTTGAAAATGG + Intergenic
988556798 5:32243927-32243949 CAGGCTGTTAATTCTAGAAGTGG + Intronic
989020998 5:37008721-37008743 CAGGTAATTAATTATAACAGAGG + Exonic
989164434 5:38420907-38420929 CATGCCATTAATATTCACAGAGG - Intronic
991133092 5:63149046-63149068 CTGGCCAGTAATTTTACAAAAGG - Intergenic
991274550 5:64829259-64829281 TAAGCCATTAATTCTAAAATTGG - Intronic
991944770 5:71889440-71889462 CCAGCCAATATTTTTAAAAGGGG - Intergenic
992800724 5:80293432-80293454 CAAACCATTGATTTGAAAAGGGG + Intergenic
993288943 5:86039887-86039909 CAGGCCATGTATTTGAAAAAAGG + Intergenic
995698932 5:114911909-114911931 TAGACCATTAATATTTAAAGTGG - Intergenic
997696014 5:135861654-135861676 CATACCACTATTTTTAAAAGAGG - Intronic
998709211 5:144802680-144802702 CAGGTCAAGATTTTTAAAAGAGG + Intergenic
999515353 5:152296782-152296804 CAGGTCATTAATTATAAAAGAGG + Intergenic
1000697776 5:164410116-164410138 AAGTCTATTAATTTTAAAAATGG + Intergenic
1000822379 5:166000495-166000517 CTGGCTTTTAATGTTAAAAGGGG - Intergenic
1001222145 5:169910226-169910248 CAGGCCTTTCATGTTAGAAGTGG + Intronic
1001696056 5:173670890-173670912 CAGGCAATTAGATTTTAAAGCGG + Intergenic
1003740392 6:8930559-8930581 CAGGCCAATATTTTTAACACTGG + Intergenic
1004770344 6:18774154-18774176 CAGCCCATTATTTTCAAAGGAGG + Intergenic
1004912909 6:20303963-20303985 CAGGCCAATGCTTTTCAAAGAGG + Intergenic
1006265211 6:32915690-32915712 CAGGACCATATTTTTAAAAGAGG + Intergenic
1006809734 6:36812127-36812149 CAGGCCACTGACTTTCAAAGTGG - Intronic
1007123594 6:39403985-39404007 CAGTTCATTTATTTTAAAAATGG - Intronic
1008778313 6:55068591-55068613 CAGTCCATTAATTTTAAACAAGG - Intergenic
1008866859 6:56222321-56222343 CAGGCAACTAATTGTAAAATAGG + Intronic
1009202854 6:60767215-60767237 GAGGCCACTAGTTTTAGAAGAGG - Intergenic
1009674543 6:66801101-66801123 CAGGGCATTAATCTTAAAAGCGG - Intergenic
1012008362 6:93746107-93746129 CAAGGCATTTATTTTAAAAATGG - Intergenic
1012713741 6:102641474-102641496 TAGACAATTAATTTTAGAAGAGG + Intergenic
1014131899 6:117845026-117845048 CAAGCCATAAATTTGATAAGGGG + Intergenic
1014165063 6:118214935-118214957 CAGTTGATTACTTTTAAAAGAGG - Intronic
1014862719 6:126489248-126489270 CAGGCCATACATTCTATAAGGGG - Intergenic
1016427968 6:143954377-143954399 CAGGATATTATTTTTTAAAGAGG + Intronic
1017352994 6:153465998-153466020 CAGTCCATTCATTTTATCAGAGG - Intergenic
1018160604 6:161038618-161038640 CATGCCATTAAGTTTCACAGTGG - Intronic
1018496506 6:164352317-164352339 CCTACCATTAATTTAAAAAGAGG - Intergenic
1020636994 7:10708330-10708352 CAAGCCCTTAATTTTAAATACGG + Intergenic
1020915066 7:14183355-14183377 GAAGACATAAATTTTAAAAGGGG + Intronic
1021251360 7:18330381-18330403 ATGTCCATTAATTTTAATAGTGG - Intronic
1021391620 7:20100296-20100318 CTTGCCATTAATTTTAACAGCGG - Intergenic
1021906847 7:25343009-25343031 CAGGTCACTAATTTTAAAAAAGG + Intergenic
1024736749 7:52313260-52313282 GAGGCAATTAATGTTAAATGAGG + Intergenic
1027567963 7:79822274-79822296 CAGGCAATTAATTTTGAATTAGG - Intergenic
1027816816 7:82984459-82984481 CAGAAGATTCATTTTAAAAGGGG + Intronic
1028657140 7:93221394-93221416 AAGGCCATCAATTTTAAAAAGGG + Intronic
1028706530 7:93854954-93854976 CAGGAGAAAAATTTTAAAAGTGG + Intronic
1029456803 7:100675792-100675814 CAAGCACCTAATTTTAAAAGGGG - Intronic
1030524605 7:110637992-110638014 CAGCCCATTAAATTTAAGATAGG - Intergenic
1031687156 7:124745029-124745051 CAGTCCAATACTTTTCAAAGGGG - Intergenic
1034545763 7:151787770-151787792 CAGGCAATTAATTTAAAATGAGG + Intronic
1035063238 7:156085074-156085096 CAGGTAATCAATTTTAAAAATGG - Intergenic
1035428913 7:158802709-158802731 TAGGCTATTAATTTTTAAAGAGG - Intronic
1036180636 8:6581491-6581513 CAGGCTAATAATTTTTAAAAAGG - Intronic
1036511311 8:9402917-9402939 CCTTCCCTTAATTTTAAAAGAGG - Intergenic
1037222981 8:16548175-16548197 CAGACCATAAGTTTTAAGAGAGG - Intronic
1038137425 8:24802743-24802765 AAGTCTATTAATTTTAAATGTGG + Intergenic
1038560614 8:28575919-28575941 CAGTTTAGTAATTTTAAAAGTGG - Intergenic
1039329460 8:36521213-36521235 GAGGCCATTTATTTAAAATGGGG + Intergenic
1041970154 8:63731586-63731608 CAGGCAAACGATTTTAAAAGTGG - Intergenic
1042221542 8:66479198-66479220 CTGACCATGACTTTTAAAAGTGG - Intronic
1042580408 8:70271467-70271489 AAGGCATTTAATTTTAAAGGAGG - Intronic
1043912894 8:85884347-85884369 CAGGCCATTCAATGGAAAAGAGG - Intergenic
1045019744 8:98031599-98031621 AAAGGCATTAATTTTAACAGTGG - Intronic
1046359742 8:113134768-113134790 TAGGTAATTAATTTTAAAAAGGG + Intronic
1047097205 8:121638999-121639021 CAGGTTATTATTTTTAAAAAAGG - Intronic
1047972336 8:130095918-130095940 CAGGCCAGTAATTCTTAAGGAGG + Intronic
1048337917 8:133516683-133516705 CAGGGCAGCAATTATAAAAGTGG + Intronic
1048534535 8:135280537-135280559 CAATCCTTTAATTTTACAAGTGG - Intergenic
1050735871 9:8762614-8762636 CAGGCCATTAATTTTAAAAGAGG - Intronic
1051001924 9:12292659-12292681 CAGACCAAGCATTTTAAAAGAGG - Intergenic
1052030626 9:23624427-23624449 CAGGTCTTTAGATTTAAAAGGGG - Intergenic
1052251528 9:26403741-26403763 TGGGACATTCATTTTAAAAGTGG + Intergenic
1057391340 9:94643616-94643638 GAGCCCAGGAATTTTAAAAGCGG + Intergenic
1058193736 9:101950093-101950115 CATGACATTAAAATTAAAAGTGG + Intergenic
1058348171 9:103989844-103989866 CATGTCATTAATTTGAAATGGGG + Intergenic
1058353726 9:104057932-104057954 TAGGATATTAAATTTAAAAGTGG + Intergenic
1061343057 9:129998787-129998809 GAGGCCAGTAATTTTTAAGGTGG - Intronic
1061630875 9:131871441-131871463 CAGGCCCTTGCTTTTTAAAGAGG - Intronic
1186884424 X:13898917-13898939 CATGATACTAATTTTAAAAGCGG + Intronic
1187593335 X:20743168-20743190 CATGCAATTTATTTTAAAAGAGG + Intergenic
1188372110 X:29381351-29381373 CAAGTCATTAATTTGAATAGAGG - Intronic
1188819655 X:34759147-34759169 CAACCAATTAATTTTAGAAGAGG + Intergenic
1190423363 X:50308634-50308656 AAAGCCATTAGTTTTAAAGGAGG + Exonic
1190879133 X:54480303-54480325 CAGGCCATCCATTTTACAAAAGG - Intronic
1192249193 X:69397063-69397085 GAGGCCATTGATTTGAATAGAGG - Intergenic
1192875640 X:75226681-75226703 GAGTACATTAATTTTAAATGTGG - Intergenic
1193216312 X:78868411-78868433 CAGGCCATTTATTTTAAAGATGG - Intergenic
1193803546 X:85966713-85966735 CATGCCTTTAATTTTAAGAAAGG + Intronic
1194182725 X:90734032-90734054 TAGGCCAATATTTTTAAGAGAGG + Intergenic
1195078264 X:101348057-101348079 CAGCCCAGTAACTATAAAAGTGG - Intronic
1196108600 X:111922227-111922249 CTGGCCATTAATTACAAATGGGG - Intronic
1197008262 X:121530357-121530379 CAAGCCGTTAAATTTAGAAGTGG - Intergenic
1197095633 X:122591358-122591380 CAGGCCTTTATTTATAAAATTGG - Intergenic
1197443649 X:126521805-126521827 CAGGTCTTTATTTTTAACAGGGG - Intergenic
1197636363 X:128919179-128919201 TAGGCAATTCATTTTTAAAGAGG - Intergenic
1200529345 Y:4315987-4316009 TAGGCCAATATTTTTAAGAGAGG + Intergenic
1201516776 Y:14826431-14826453 CAGGACAATCATTTTAAAACTGG - Intronic
1201558138 Y:15286336-15286358 CAGGCCATGAATTATATGAGGGG - Intergenic