ID: 1050736010

View in Genome Browser
Species Human (GRCh38)
Location 9:8764248-8764270
Sequence AGCCATATGTTTCATTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050736009_1050736010 5 Left 1050736009 9:8764220-8764242 CCTACTCTACATATTTTACTGTG 0: 1
1: 0
2: 0
3: 19
4: 251
Right 1050736010 9:8764248-8764270 AGCCATATGTTTCATTACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050736010 Original CRISPR AGCCATATGTTTCATTACAA AGG Intronic
No off target data available for this crispr