ID: 1050736488

View in Genome Browser
Species Human (GRCh38)
Location 9:8769033-8769055
Sequence GCTAACACACAGAATTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050736488_1050736492 18 Left 1050736488 9:8769033-8769055 CCCACCTAATTCTGTGTGTTAGC 0: 1
1: 0
2: 0
3: 7
4: 144
Right 1050736492 9:8769074-8769096 AATGATTTATGAATCACCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050736488 Original CRISPR GCTAACACACAGAATTAGGT GGG (reversed) Intronic
901569446 1:10147747-10147769 GCTCACTCTCTGAATTAGGTGGG - Intronic
908447539 1:64215068-64215090 ACTAAAATACAGAATTAGCTGGG + Intronic
914897141 1:151686532-151686554 GCTAGTACACAGAAATATGTTGG - Intronic
915264537 1:154707359-154707381 GCAAACACACAGGTTTATGTGGG + Exonic
918784617 1:188749858-188749880 GCTAACACTCAGAATTCTCTCGG - Intergenic
919998838 1:202779316-202779338 GCTAACACAAAAAATTAGCCAGG + Intronic
924597853 1:245463010-245463032 GATAGCACACAGTATGAGGTGGG + Intronic
1064171789 10:13040166-13040188 GCGAACACAGTGAATTAGGATGG + Intronic
1065774595 10:29107613-29107635 GCTAACTCAGAGAACTCGGTGGG + Intergenic
1067536240 10:47112312-47112334 GGTAACACACAGAATAAAGTGGG + Intergenic
1069300028 10:66895934-66895956 AAGAACACACAGAATTAGCTGGG + Intronic
1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG + Intronic
1075600308 10:123762675-123762697 TCAAACATACAGAATTAGGGAGG - Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1081530549 11:43955884-43955906 GCTAACTCCCAAAATTAGCTTGG + Intergenic
1081585212 11:44379633-44379655 ACTCCCACACAGACTTAGGTTGG + Intergenic
1082971812 11:59030647-59030669 GCTTACTCAAGGAATTAGGTAGG + Intronic
1085108464 11:73866530-73866552 GCTAAAAGAGACAATTAGGTTGG - Intergenic
1086853690 11:91841093-91841115 GCTAAAACACAGAAATAGCTTGG + Intergenic
1088270946 11:108033919-108033941 GCTAGCAAACAGAATTAGTGGGG - Intronic
1090244954 11:125209647-125209669 GCTAACACACAGTAATAGATGGG + Intronic
1090399784 11:126441620-126441642 GAGAACACACAGAATTATGCAGG + Intronic
1097552586 12:61094074-61094096 GCTACCAAACAGAAATATGTAGG - Intergenic
1099742154 12:86652570-86652592 GCTGATAGACTGAATTAGGTAGG + Intronic
1102105260 12:110315924-110315946 GCAAACAAACAAAATTAGCTTGG + Intronic
1102882998 12:116500426-116500448 CCTAGCACAGAGTATTAGGTTGG + Intergenic
1105754179 13:23449651-23449673 GCAAACACACAAAAGAAGGTTGG + Intergenic
1105884622 13:24631238-24631260 TCTAAGACACAGAATGAGATAGG + Intergenic
1106531917 13:30601373-30601395 GGTAAGACACAGAACCAGGTAGG - Intronic
1107036468 13:35907518-35907540 GCATACACACAGACTGAGGTGGG - Intronic
1107661816 13:42646737-42646759 GCACACACACAAAATTAGCTAGG - Intergenic
1107903608 13:45042324-45042346 ACTAAAACACAAAATTAGCTGGG + Intergenic
1111076227 13:83239548-83239570 GTGAACACAAAGAATTAAGTGGG + Intergenic
1112265589 13:97920444-97920466 GGTCACACACAGATATAGGTGGG - Intergenic
1112928153 13:104702907-104702929 GCTAATATACAGATTTAGTTTGG + Intergenic
1114965930 14:27959208-27959230 GTTAACACACAGAATTAACCAGG + Intergenic
1115056787 14:29137629-29137651 GTTGGCACATAGAATTAGGTTGG + Intergenic
1117372339 14:55089999-55090021 GCTAAAATACAAAATTAGCTGGG - Intergenic
1118893452 14:69927513-69927535 GCTAATACAAAAAATTAGCTGGG + Intronic
1119281198 14:73409524-73409546 GTTAACATACAGCATGAGGTGGG - Intronic
1122350310 14:101085647-101085669 GCTAAAATACAAAATTAGCTGGG + Intergenic
1122581674 14:102775774-102775796 GGTAACACACAGCATAAGGCAGG + Intergenic
1123820915 15:24029494-24029516 GCAAACACACAGAATTTCTTAGG - Intergenic
1124143453 15:27098023-27098045 GGTAACACACAGAAAGAGTTAGG + Intronic
1128406948 15:67351280-67351302 GAGAACACACAGACTTAGGGAGG - Intronic
1130782780 15:87061100-87061122 GCTAACACCATGAATTAGTTTGG - Intergenic
1133270911 16:4610425-4610447 GCTTATACACAGAACTAGCTCGG + Intronic
1133346914 16:5077471-5077493 GGTAACACACAGGTTCAGGTGGG - Exonic
1133913927 16:10091490-10091512 ACAAACACACAAAATTAGCTGGG + Intronic
1134046853 16:11107512-11107534 ACTAGCACACTCAATTAGGTTGG - Intronic
1134187494 16:12096210-12096232 GCTAATACACAAAATTCAGTGGG - Intronic
1134444839 16:14322849-14322871 ACAGACACACAAAATTAGGTGGG - Intergenic
1136368154 16:29819154-29819176 GCCAACACAAAAAATTAGCTGGG - Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1143480256 17:7224069-7224091 GGTAAGACAGAGAATTGGGTGGG + Exonic
1147063000 17:37897188-37897210 TCTAAGTCACAGAATGAGGTAGG + Intergenic
1156428367 18:37042039-37042061 ACAAACAAACAAAATTAGGTAGG - Intronic
1156787789 18:40936648-40936670 ACTCACCCACAGAATTGGGTGGG + Intergenic
1161544811 19:4874011-4874033 GCTAAGACACAGAATAAGACTGG + Intergenic
1161830799 19:6602746-6602768 ACACACACACAGAATTAGGGTGG + Intronic
1162665793 19:12210712-12210734 GCACACACACAAAATTAGCTGGG - Intergenic
1168022762 19:53621622-53621644 GCTAATACAAAAAATTAGCTGGG + Intergenic
925071348 2:970210-970232 GCTTATCCACACAATTAGGTAGG - Intronic
925816821 2:7761277-7761299 GCTAACAAAAAGAAATAGCTGGG - Intergenic
926017387 2:9466434-9466456 GCACACACACAAAATTAGCTGGG + Intronic
928166411 2:28975775-28975797 TCTAGCACACAGATCTAGGTGGG + Intronic
929527408 2:42718406-42718428 ACTAAAACACAAAATTAGCTGGG - Intronic
931100455 2:58994045-58994067 GCTAATACAAAAAATTAGGTGGG - Intergenic
931305983 2:61028790-61028812 GCTCACACACTGCATTTGGTTGG - Intronic
932944604 2:76212994-76213016 GCTCCCTCACAGAATTAAGTCGG - Intergenic
934669755 2:96203803-96203825 ATAAACACACAAAATTAGGTGGG + Intronic
935310713 2:101780473-101780495 GACAAAACACAGAATTATGTGGG - Intronic
942673782 2:178405316-178405338 ACTAAAACACAAAATTAGGTGGG - Intergenic
946134078 2:217631308-217631330 GCTAACACATGGATTTATGTGGG - Intronic
946231446 2:218293741-218293763 GCAAACAAACAAAATTAGCTGGG - Intronic
1168882909 20:1223329-1223351 AAAAACACACAAAATTAGGTGGG + Intergenic
1169415193 20:5409999-5410021 TCTAAAACACAGAATAAGATTGG - Intergenic
1173039486 20:39448046-39448068 GCTAACATCCAGAATCAGTTTGG - Intergenic
1173115648 20:40240324-40240346 ACTATCACAAAGAATGAGGTAGG + Intergenic
1177710087 21:24762793-24762815 CAAAACACACAAAATTAGGTAGG - Intergenic
1178094435 21:29198540-29198562 ACAAACACACAAAATTAGCTGGG + Intronic
1181955825 22:26587273-26587295 GCTGGCACACAGTATTAGGAGGG - Intronic
1183104142 22:35604181-35604203 ACTAACATACAAAATTAGCTGGG - Intergenic
1184543911 22:45152458-45152480 GAGAACACACTGAATTAGCTGGG + Intergenic
951848142 3:27106468-27106490 GCAAACACACAGAATATGGAGGG + Intergenic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
957452226 3:80393896-80393918 GCTAAGAAATAGAATTACGTGGG + Intergenic
957730536 3:84127881-84127903 GCTAAGACACAGAACAAGGTAGG - Intergenic
958019181 3:87977758-87977780 GCTCACACACACTATTATGTGGG + Intergenic
958966300 3:100562654-100562676 GCTAGCATACAGATTCAGGTTGG - Intronic
959582567 3:107996848-107996870 ACTATGACAAAGAATTAGGTAGG - Intergenic
959885956 3:111500360-111500382 ACTAACACAAATAATAAGGTAGG + Intronic
960226258 3:115172701-115172723 GCAAACAAACAGAATGAGCTTGG + Intergenic
961404804 3:126671300-126671322 GCTAATACACAATACTAGGTGGG - Intergenic
962386612 3:134937319-134937341 GAGAACACACAGAATGTGGTGGG + Intronic
966293739 3:178392647-178392669 GCAAAAACACTGACTTAGGTTGG - Intergenic
966960775 3:184936504-184936526 ACACACACACAGTATTAGGTTGG - Intronic
970618021 4:17786016-17786038 CCTAACGGACAGAATAAGGTGGG + Intergenic
972004779 4:34087060-34087082 AGTAACACACAGAATTGGGAAGG + Intergenic
974297694 4:60023548-60023570 GGTAACACACAGAGGAAGGTGGG - Intergenic
974922982 4:68265142-68265164 TCTAACTCACAGAATGAGATAGG + Intergenic
975802450 4:78075283-78075305 GCTGACACACAGAAGTTGATAGG + Intronic
976135228 4:81928951-81928973 ACTAACAAACAGAATTTGGAGGG - Intronic
977500876 4:97835086-97835108 TCTAACTCACAGGATTAGATAGG + Intronic
978799695 4:112743434-112743456 ACTAACACATGTAATTAGGTTGG + Intergenic
979882840 4:125984397-125984419 GTAAACATACAGAATTAGCTAGG + Intergenic
980422354 4:132580157-132580179 GCTCACACACAGCTTTAGTTAGG - Intergenic
981617496 4:146656540-146656562 GATAATAGTCAGAATTAGGTGGG - Intergenic
984099979 4:175473126-175473148 GCTAACACTCAAAATTATCTCGG + Intergenic
984609999 4:181827168-181827190 GCTAACAGACACAATCAGTTGGG - Intergenic
987827003 5:23044909-23044931 TCTAACACACTGCATTATGTAGG - Intergenic
989823519 5:45825262-45825284 GCCAAGGCACAGAATTAGGGAGG + Intergenic
992059037 5:73023738-73023760 TTTAACACACAGAAATATGTTGG + Intronic
999410879 5:151348695-151348717 GCTAACCCACAGAAGTAGCCAGG - Intergenic
1008364500 6:50661292-50661314 ACTAACAAACAAAAATAGGTAGG + Intergenic
1009895345 6:69742661-69742683 GCTTACACTTAAAATTAGGTTGG - Intronic
1010864873 6:80963298-80963320 GCAAACAAACAGAATAAGATGGG - Intergenic
1011044782 6:83068774-83068796 GATAACACAGTGATTTAGGTGGG + Intronic
1012950402 6:105512205-105512227 ACTAAAATACAAAATTAGGTGGG - Intergenic
1014521121 6:122443411-122443433 GTCTACACACAGAATAAGGTTGG + Exonic
1014787747 6:125637793-125637815 CCTAACAATCAGAAGTAGGTAGG - Intergenic
1016043026 6:139452109-139452131 CCTAACACACACAATTACATTGG - Intergenic
1016732058 6:147437690-147437712 GCTCAAACACAGAATTAGCCAGG - Intergenic
1017234660 6:152106747-152106769 GCAAACAAACAAAATTAGCTGGG - Intronic
1021409198 7:20309707-20309729 GCCAACACACACAATCATGTAGG + Intergenic
1021709380 7:23400275-23400297 TCTAAAACAAAGTATTAGGTTGG + Intronic
1021816756 7:24454622-24454644 ACAAACAAACAAAATTAGGTGGG - Intergenic
1022478281 7:30726338-30726360 ACTAAAACACAAAATTAGCTAGG - Intronic
1024142535 7:46476907-46476929 TCTCAAACACAGAAATAGGTTGG + Intergenic
1024252827 7:47519458-47519480 GCTCACACACTGAGTGAGGTGGG - Intronic
1027351654 7:77317781-77317803 GTTAACACAAAAAATTTGGTAGG - Intronic
1028971958 7:96869179-96869201 ATTAATACACAGAATGAGGTTGG + Intergenic
1031380374 7:121078587-121078609 GCCAACATACAGAAATAGTTAGG - Intronic
1033540543 7:142352277-142352299 GCAAACTCACAGAATTATTTTGG - Intergenic
1033955270 7:146839924-146839946 GCAAAGACACAGAATTGGATTGG + Intronic
1034586322 7:152096552-152096574 ACTAAAATACAAAATTAGGTGGG + Intronic
1037134239 8:15443327-15443349 ACACACACACACAATTAGGTGGG - Intronic
1039563789 8:38534558-38534580 GCTAAAACTCAGAACTAGGCTGG - Intergenic
1042113107 8:65402546-65402568 ACTAAAACACAAAATTAGCTGGG + Intergenic
1043004825 8:74806452-74806474 GGTAACACACAAAATTAGTCTGG - Intronic
1044615053 8:94131482-94131504 TCAAACACACATATTTAGGTTGG + Intronic
1045912916 8:107431285-107431307 GCAAAAACACAGATTTTGGTTGG + Intronic
1050736488 9:8769033-8769055 GCTAACACACAGAATTAGGTGGG - Intronic
1051286314 9:15500824-15500846 TCTAAGATACAGAACTAGGTAGG + Intronic
1052303674 9:26981573-26981595 ACACACACACAAAATTAGGTGGG - Intronic
1055082684 9:72282590-72282612 GCTTTCACAGAGAAATAGGTAGG - Intergenic
1057084084 9:92192659-92192681 GCACACACACAAAATTAGCTGGG - Intergenic
1058674458 9:107388629-107388651 GCTAAATGTCAGAATTAGGTTGG + Intergenic
1059659965 9:116390959-116390981 CCTACCACACAGAAGTATGTTGG - Intronic
1187096888 X:16158127-16158149 CCTCAGACACAGAACTAGGTGGG - Intergenic
1190388696 X:49910678-49910700 GTACACACACAGATTTAGGTAGG - Intergenic
1190948725 X:55121192-55121214 GCTCAGACACAGAAGGAGGTGGG - Intronic