ID: 1050737741

View in Genome Browser
Species Human (GRCh38)
Location 9:8783618-8783640
Sequence ACACACTACCTCATACCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050737738_1050737741 -4 Left 1050737738 9:8783599-8783621 CCATACCCTGGTCATTAGAACAC 0: 1
1: 0
2: 0
3: 5
4: 92
Right 1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG No data
1050737736_1050737741 0 Left 1050737736 9:8783595-8783617 CCCACCATACCCTGGTCATTAGA 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG No data
1050737739_1050737741 -9 Left 1050737739 9:8783604-8783626 CCCTGGTCATTAGAACACACTAC 0: 1
1: 0
2: 0
3: 7
4: 107
Right 1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG No data
1050737740_1050737741 -10 Left 1050737740 9:8783605-8783627 CCTGGTCATTAGAACACACTACC 0: 1
1: 0
2: 0
3: 6
4: 67
Right 1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG No data
1050737737_1050737741 -1 Left 1050737737 9:8783596-8783618 CCACCATACCCTGGTCATTAGAA 0: 1
1: 0
2: 1
3: 19
4: 276
Right 1050737741 9:8783618-8783640 ACACACTACCTCATACCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050737741 Original CRISPR ACACACTACCTCATACCTCA AGG Intronic
No off target data available for this crispr