ID: 1050739227

View in Genome Browser
Species Human (GRCh38)
Location 9:8801424-8801446
Sequence CTGTGCTTGGCCAGGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 0, 2: 4, 3: 51, 4: 309}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050739227_1050739232 8 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739232 9:8801455-8801477 GCCTGTAATCTCAGCAATCTGGG 0: 8
1: 630
2: 23302
3: 271211
4: 341818
1050739227_1050739236 20 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739236 9:8801467-8801489 AGCAATCTGGGAGGCTGAGGCGG 0: 27
1: 2470
2: 72982
3: 175522
4: 187254
1050739227_1050739234 11 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739234 9:8801458-8801480 TGTAATCTCAGCAATCTGGGAGG 0: 12
1: 929
2: 32280
3: 352456
4: 329979
1050739227_1050739237 21 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739237 9:8801468-8801490 GCAATCTGGGAGGCTGAGGCGGG 0: 24
1: 2651
2: 78450
3: 283910
4: 424417
1050739227_1050739235 17 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739235 9:8801464-8801486 CTCAGCAATCTGGGAGGCTGAGG 0: 8
1: 318
2: 11448
3: 130532
4: 355900
1050739227_1050739238 24 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739238 9:8801471-8801493 ATCTGGGAGGCTGAGGCGGGCGG 0: 11
1: 968
2: 29516
3: 143118
4: 211049
1050739227_1050739231 7 Left 1050739227 9:8801424-8801446 CCATCAAACCTGGCCAAGCACAG 0: 1
1: 0
2: 4
3: 51
4: 309
Right 1050739231 9:8801454-8801476 CGCCTGTAATCTCAGCAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050739227 Original CRISPR CTGTGCTTGGCCAGGTTTGA TGG (reversed) Intronic
900018570 1:171225-171247 CTGTGCTTGGCCACGATGAAAGG + Intergenic
900071059 1:771644-771666 CTGTGCTTGGCCACGATGAAAGG + Intergenic
900281936 1:1875478-1875500 GTGTCCTTGGCCAGGTGTGATGG - Intronic
901000830 1:6148018-6148040 CTGTGCTTTCCTAGGATTGATGG - Intronic
902407640 1:16194224-16194246 CTGAGATTGGCCAGGTGTGGTGG - Intergenic
902510883 1:16966367-16966389 CTGTGCTTGGCCATGCCTGACGG + Intronic
903409062 1:23124964-23124986 TTGAGCTTGCCCAGGTTTGGAGG + Intronic
903631493 1:24776651-24776673 CTGAGTTTGGCCAGGTGTCATGG + Intronic
906163555 1:43669092-43669114 CGGTGCTTGGCCAGGCTGCAAGG - Exonic
906265374 1:44424825-44424847 AGGTGCTTGGCCAGATGTGAGGG + Intronic
907310788 1:53537998-53538020 CTGCGTTTGGCCAGCTTTAAAGG + Intronic
909721049 1:78769835-78769857 CTGTGCCTGGCCAGATATGCAGG + Intergenic
910430283 1:87153224-87153246 CTGTGCAGGGCTAGGTGTGAGGG + Intronic
912512325 1:110197941-110197963 CTGTGCCTGGCCAGGATGGTGGG + Intronic
914828526 1:151153665-151153687 TTGTTCTTGGCCAGGTGTGGTGG + Intergenic
916450996 1:164920286-164920308 CTGGGCTTGGCTGGGTGTGATGG - Intergenic
916530791 1:165654294-165654316 CTGGGCTTGGCCTGGATTGTTGG + Exonic
917564489 1:176198424-176198446 CTGTGTTTGGTAAGGGTTGAAGG - Intronic
917632656 1:176905112-176905134 CTCTTCTTGTCCAGATTTGAAGG - Intronic
917868504 1:179221298-179221320 CTGTGCCTGGCCAGTTTTCAAGG - Intronic
917958718 1:180125848-180125870 CTGTGCCTGGCCTGTTGTGAAGG - Intergenic
918187708 1:182142738-182142760 CTGTGCTTGGTCAGGCTTCATGG + Intergenic
918251688 1:182708680-182708702 TTGTTCTTGGCCGGGTTTGAGGG - Intergenic
919886068 1:201935842-201935864 CTGGGATTGGCCAGGTGTGGTGG - Intronic
920903584 1:210137111-210137133 CAGTGTTTGGGCAGATTTGAAGG + Intronic
921132746 1:212233854-212233876 CTTTGCTTGGCCATGGTAGATGG - Intergenic
923382038 1:233430860-233430882 CTGTGCCCTGCCAGGTGTGATGG - Intergenic
923552801 1:234977652-234977674 CTGTGCCTGGCCAAGTGTGAGGG - Intergenic
924348604 1:243094659-243094681 CTGTGCTTGGCCACGATGAAAGG + Intergenic
924483765 1:244460624-244460646 CTGTGCCTGGCCAGGTCTGGTGG + Intronic
924645857 1:245876864-245876886 CTCTGCCTGGCCAGGATTTAGGG + Intronic
1062978858 10:1705240-1705262 CTGTGCTTGGCAGGGTTGCAGGG + Intronic
1063246528 10:4225461-4225483 CTGTCTTTGGCCAGGCTTGGTGG - Intergenic
1063490328 10:6458222-6458244 CTGCGCCTGGCCAGCTCTGAGGG + Intronic
1063843106 10:10093679-10093701 ATTTGCTTGGCCAGGCATGATGG + Intergenic
1064192902 10:13222935-13222957 CTGTGATTGGCCAGGCGGGATGG + Intronic
1064744223 10:18463234-18463256 CTGTTCTTGGCCAGGCATGGTGG + Intronic
1066019313 10:31281833-31281855 CTGTAATTGGCCAGGTGTGGTGG - Intergenic
1066727755 10:38410242-38410264 CTGTGCTTGGCCACGATGAAAGG - Intergenic
1067429139 10:46231357-46231379 CTGTGGGTGGCCAGGGTGGAGGG + Intergenic
1069443556 10:68451875-68451897 CTGTCCATGGCCAGGTGTGGTGG - Intronic
1069627774 10:69878766-69878788 TTGTGCTTGGCCAGGCATGGTGG - Intronic
1069641207 10:69956609-69956631 CTGTCCTTGCCAAGGTTTTATGG + Intronic
1069686934 10:70324504-70324526 CTGTGGTTGGCCAGGGGAGAAGG - Intronic
1070532215 10:77346922-77346944 CTGTGCTTGGCCATGTTTCTTGG - Intronic
1071558780 10:86628978-86629000 CTGGGCGTGGCCAGGTGTGGTGG + Intergenic
1071968563 10:90878247-90878269 CTGTGCTTGAGCAGGTAAGAGGG - Intronic
1072420828 10:95289922-95289944 CTGTGTTTGGCCAGATTAAATGG + Intronic
1072680351 10:97501297-97501319 CTGTACTTGGCCAGGCGTGGTGG + Intronic
1073653228 10:105383729-105383751 CTGGGCATTGCCAAGTTTGACGG + Intergenic
1076975175 11:166421-166443 CTGTGCTTGGCCACGATGAAAGG + Intergenic
1077627197 11:3783098-3783120 CTGTGCCTGGCCAGAGGTGAGGG - Intronic
1080941777 11:36926731-36926753 CTGAGCTAGGCCAGGGTGGACGG + Intergenic
1081540710 11:44032720-44032742 CTCTGCAGGTCCAGGTTTGAGGG + Intergenic
1082874114 11:57970725-57970747 CCGTGCCTGGCGAGATTTGATGG + Intergenic
1082877409 11:58002241-58002263 CTGTGCTTGGCCAGGTGTGGTGG - Intergenic
1083406724 11:62462492-62462514 CTGTGCTTGGCTGCTTTTGAGGG - Intronic
1083601439 11:63950970-63950992 CTGTGTTTGGGCAGCTGTGATGG + Intronic
1084547946 11:69823749-69823771 CTGGGCGAGGCCAGGCTTGATGG + Intergenic
1084635821 11:70391836-70391858 CTGTGCCTGGCCAGTTTTTCAGG - Intergenic
1084977162 11:72807860-72807882 CTTTGCTTGGCCAGGTGTGGTGG + Intergenic
1085658378 11:78338720-78338742 CTGTGGTTGTTCTGGTTTGAAGG + Intronic
1085664851 11:78405384-78405406 ATGTGCTTGGCCAGGCGTGGTGG - Intronic
1086230899 11:84568648-84568670 CTTTGCCTGGGCAGGTTTGTTGG - Intronic
1086721765 11:90129415-90129437 CTGTCCTTGGTCAGGTTAGCTGG + Intergenic
1090293198 11:125564483-125564505 CTGTTCCTGGCCAGGTGTGGTGG + Intergenic
1090436903 11:126694536-126694558 CTGTTCTAGGGCAGGTTTGGGGG + Intronic
1092179740 12:6437500-6437522 CTGTGCTCGGCCAGGTATGGGGG + Intergenic
1095438189 12:42214711-42214733 CTGTGCCTGGCCAGCTCTCATGG - Intronic
1097291812 12:57922990-57923012 CTGTTCTAGGCCAGGCTTGGTGG - Intergenic
1098312220 12:69159373-69159395 CTGAGCTGGGCCAGGTGTGATGG - Intergenic
1101478102 12:105070591-105070613 CTGTGCCTGGGCAGGATGGATGG + Exonic
1101830026 12:108249778-108249800 CTTTGCATGGCCAGGTTCCAAGG - Exonic
1102392210 12:112558286-112558308 ACGTGCTTGGCATGGTTTGAAGG - Intergenic
1104815023 12:131640569-131640591 CTGTGCTGGGGAAGGGTTGAGGG + Intergenic
1106872225 13:34034114-34034136 CTGTAATTGTCCAGGTTCGAAGG + Intergenic
1107921343 13:45211554-45211576 TTGAGCTTGGCCAGGTATGGTGG - Intronic
1108758426 13:53532433-53532455 CTGGGTTTGGTGAGGTTTGACGG - Intergenic
1109233794 13:59791255-59791277 CTGTTCTTGACCAGGAATGATGG - Intronic
1109729326 13:66390446-66390468 CTGGGCAAGGCCAGGTGTGATGG + Intronic
1110852575 13:80262389-80262411 CTGTTCTGGTCCAGGTTTCAGGG + Intergenic
1112011566 13:95297996-95298018 CTGTGCCTGGGCCAGTTTGAGGG - Intronic
1113238108 13:108304285-108304307 ATGCCCCTGGCCAGGTTTGAGGG + Intronic
1113987793 13:114332350-114332372 CTGTGCTTGGCCGGGCGTGGTGG + Intergenic
1114527553 14:23376182-23376204 CTGTGCTGGGCCAGGGTAGCAGG - Exonic
1115202360 14:30868453-30868475 CTTAACTTGGCCAGGTGTGATGG + Intergenic
1115440879 14:33434237-33434259 CTGTAGTTGGCCAGGTGTGGTGG + Intronic
1115499309 14:34035302-34035324 CTGGGCTTGGCCAGGCATCAAGG - Intronic
1115602710 14:34970930-34970952 CTCTTCTTGGCCAGGTGTGGTGG - Intergenic
1115981217 14:39053841-39053863 CTGAGCTTAGCCAGGTGTGGTGG + Intronic
1116879377 14:50149181-50149203 ATGTGCTTGGCTGGGTATGATGG - Intronic
1117460744 14:55942496-55942518 TTTTTCTTGGCCAGGATTGAAGG + Intergenic
1118268952 14:64323491-64323513 GTGTGCTTGGCCAGGCATGGTGG - Intronic
1118666684 14:68077666-68077688 TTGTGCTTGGCCAGGAGTGGTGG + Intronic
1120289147 14:82545047-82545069 CTGGCCTTGGCAAGTTTTGATGG - Intergenic
1121350853 14:93171450-93171472 CTGTGGTTGGCCAGGTACGGTGG - Intergenic
1121491328 14:94363472-94363494 ATGTGCTAGGCCAGGATGGAGGG - Intergenic
1122470430 14:101962388-101962410 CTGGGCTGTGCCAGGGTTGAAGG - Intergenic
1122512641 14:102282117-102282139 CTGTTCTTGGCCAGGTGTGGTGG + Intronic
1122850113 14:104523444-104523466 CTGTGCGTGGCCGGGTGGGATGG - Intronic
1123629882 15:22254242-22254264 CTGTGGTTGTGCAGGGTTGAAGG - Intergenic
1124338844 15:28876875-28876897 CTCTGCCTGGCCAGGCCTGAGGG - Intergenic
1124563151 15:30793513-30793535 CTGGGTTTGGCCAGGTGTGCTGG + Intergenic
1126176430 15:45740018-45740040 CAGTGCATGCCCAGGTTTGGAGG - Intergenic
1128092428 15:64927971-64927993 ATGTGCTTGGCCAGGATAGAGGG + Intronic
1128769167 15:70268964-70268986 CTGGGCTCGGCGAGGTGTGAAGG - Intergenic
1129420055 15:75417664-75417686 CTATGCCTGGCCAGGTGTGGTGG - Intronic
1130235234 15:82127063-82127085 CTGTCTTTGGCCAGGTGTGGTGG + Intergenic
1130320262 15:82835645-82835667 CTGTGCTGGCCCAGGCCTGATGG + Exonic
1130837063 15:87661716-87661738 CTGAGCTTTGCGAGGTATGAAGG - Intergenic
1131020770 15:89096145-89096167 CTGTGCCTGGGCAGGTTCTATGG - Intronic
1134254696 16:12601487-12601509 CTGTGTATGGCCAGGTGTGCTGG - Intergenic
1134338019 16:13319295-13319317 ATGTGGTTGGCCAGGTGTGGTGG - Intergenic
1135394370 16:22119728-22119750 TAGTTCTTGGCCAGGTGTGATGG + Intronic
1136241118 16:28944809-28944831 CTAGGCTAGGCCAGGTTAGAGGG + Intergenic
1136387336 16:29937370-29937392 CTTTCCTTGGCCAGGCTTGGTGG + Intergenic
1137432278 16:48427908-48427930 CTCTGCTTGGGCAGGTGTGAGGG + Intronic
1137439463 16:48485701-48485723 CTGTGACTGGCCAGATTTGAGGG - Intergenic
1139164903 16:64554462-64554484 CTGTGCTTGGCCAGGTGCGGTGG - Intergenic
1139537970 16:67590667-67590689 CGGTGATCGGCCAGGTGTGATGG + Intronic
1139644809 16:68320681-68320703 CTGTTTTTGGCCAGATTTGGGGG + Intronic
1140572733 16:76127489-76127511 CTGTTCTTGGCCGGGCTTGGTGG - Intergenic
1141973260 16:87496513-87496535 CTGTGGTTGTGCAGGGTTGAAGG + Intergenic
1142959997 17:3546688-3546710 CTGGGCTAGGCCAGGTGTGGTGG + Intronic
1143420667 17:6789202-6789224 ATGTGAATGGCCAAGTTTGATGG + Intronic
1143589799 17:7875821-7875843 CTGTGGTTGTGCAGGTTTCAGGG - Intronic
1143772814 17:9179304-9179326 CTGGGGTTTGCCAGGTTAGAGGG - Intronic
1144848677 17:18233210-18233232 CTGTGCATAGGCAGGGTTGAGGG + Intronic
1145015246 17:19392318-19392340 CTTTGCTTGGCCTGGGTTGGGGG - Intergenic
1145070702 17:19804093-19804115 CTATGCTTGGCCAGGCGTGGTGG + Intronic
1146519245 17:33513773-33513795 CTGTCCTTGCCCAGGTTCAAAGG + Intronic
1147196134 17:38768065-38768087 CTGGGCTTGGCCAGGTTTGGAGG + Exonic
1147612518 17:41810457-41810479 CTGTACTTGGCCAGGTGTGGTGG - Intronic
1149389110 17:56171747-56171769 CTGTGCCTGGACAGTTTTAATGG - Intronic
1149438168 17:56651799-56651821 CTATTCTTGGCCAGGTGTGGTGG - Intergenic
1149725875 17:58893782-58893804 CTGTTTTTGGCCAGGCATGATGG + Intronic
1151036928 17:70811220-70811242 CTGTTCTTAGCCAGGTGTGATGG - Intergenic
1151325872 17:73379534-73379556 CTGTGCTTGTTCAGGTCTGTGGG + Exonic
1151785307 17:76272319-76272341 CTGTGCTTTCCCAGGCTGGAAGG + Intergenic
1152082527 17:78197228-78197250 CTGTGCTGGGGCAGGGTTGTTGG + Intronic
1152209421 17:78995213-78995235 CTCTGCTTGGCCAGGCTTCAAGG - Exonic
1152599163 17:81252824-81252846 CTGTGCTTGGCCAGGCAGCAGGG - Intronic
1153305354 18:3625979-3626001 TTGTGCTTGCCTAGGTTTGTGGG + Intronic
1153822275 18:8842543-8842565 CTGTGCCTGGCCAGGCATCAGGG - Intergenic
1153912915 18:9719949-9719971 GTGAGCCTGGCCAGGCTTGACGG - Intronic
1158586589 18:58743085-58743107 TTGTTCTTGGCCAGGTGTGGTGG + Intronic
1158992757 18:62886993-62887015 CTGTGCTTGAATTGGTTTGAAGG + Intronic
1160652128 19:236604-236626 CTGTGCTTGGCCACGATGAAAGG + Intergenic
1161347446 19:3775351-3775373 CTCTGCTTGGCCAGGATGGGAGG + Intergenic
1161459575 19:4388838-4388860 CTGAACTTGGCCAGGTCCGAGGG - Intronic
1161459645 19:4389190-4389212 CTGTGCTCGGGCATGTGTGATGG - Intronic
1161781249 19:6293567-6293589 CTATGGTTGGCCAGGTGTGATGG + Intergenic
1161836027 19:6647222-6647244 CTGTGATTGGCCGGATTTCAGGG + Intergenic
1162353082 19:10163252-10163274 CTGTTCTAGGCCAGGTGTGGTGG - Intronic
1162804857 19:13132127-13132149 CTGGGATTGGCCAGGTGTGGTGG + Intronic
1163306215 19:16480866-16480888 CTGGGCTTGGCCAGGCGTGGTGG + Intronic
1163834943 19:19567550-19567572 CTGTGCCTGCCCAGGTGGGAGGG + Intronic
1164883414 19:31756458-31756480 CTGTGATGGGCCAGGTGTGGTGG + Intergenic
1165897887 19:39154476-39154498 CTGAGCTGGGCCAGGGTGGAAGG + Intronic
1165992444 19:39824379-39824401 CTGTGCCTGGCCCGGCTTGCGGG - Intergenic
1166011685 19:39947418-39947440 CAGTGGTTGGCCAGGAGTGATGG - Intergenic
1166529749 19:43535172-43535194 CGGTGCGTGGCCAGCTTGGACGG - Exonic
1166991597 19:46696124-46696146 CTGTCCTTGGCCAGGCGTGGTGG - Intronic
1168665154 19:58199418-58199440 CTTGGCTTGGCCAGGTATGGTGG + Intronic
1202640113 1_KI270706v1_random:75160-75182 TTGTGCTTGGCCAGGCATGGTGG - Intergenic
925270824 2:2606245-2606267 CTGTGCTGGGCCAGGCATGTAGG - Intergenic
929609574 2:43260219-43260241 TTGTTCTTGGCCAGGTGTGGTGG - Intronic
930149792 2:48047187-48047209 CTGTTCTTTGCCAAGTTTGCAGG - Intergenic
931222996 2:60305182-60305204 CTCTTCTTTGCCTGGTTTGAAGG - Intergenic
934715293 2:96539490-96539512 CTTTGCTTCGCCAGGTTGGTTGG + Intronic
935278810 2:101499683-101499705 CTGTTGTGGGCCAGGTGTGATGG - Intergenic
935655069 2:105414841-105414863 CTGTGCCTGGCCAGATTTAAAGG + Intronic
935963856 2:108453042-108453064 CTGAGCATGGCCAGGTTTTCAGG - Intronic
937177553 2:119955648-119955670 CTGAGCTTGGCCAGGTGTGGTGG + Intronic
941677167 2:168356135-168356157 CAGTGCTTGGCCAGGTGCGGTGG + Intergenic
941933533 2:170965548-170965570 CAGTGCTGGGCCAGGTTACATGG + Intronic
943152497 2:184132388-184132410 CTGTGCCTGGCCAGTTATAATGG - Intergenic
945236737 2:207638227-207638249 CTGTGCTTGGCTAGGCGTGGTGG - Intergenic
946051626 2:216867580-216867602 CAGTGATTGGCAAGGCTTGAGGG - Intergenic
947232293 2:227900788-227900810 CTGTGCATGGCCAGAGGTGATGG + Intronic
947591391 2:231388175-231388197 CTGTGCCTGGCCAGGCTGTAGGG + Intergenic
948754195 2:240149745-240149767 TTGTGCTTGGCCAGCTGTGAAGG - Intergenic
1169949512 20:11027737-11027759 CTGTGTTTTGAAAGGTTTGAGGG + Intergenic
1170385036 20:15807023-15807045 CTTTGCTTGGCCTTGTTTTATGG + Intronic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1171511655 20:25690478-25690500 CTGTGCTTTCTCAGGTTTGAGGG - Intronic
1172954875 20:38748871-38748893 CTGGGCTGGGCTGGGTTTGAGGG + Intronic
1173448758 20:43143623-43143645 CTGTGTTTGTCCAGGTGTTAAGG + Intronic
1174080227 20:47965867-47965889 CTGTGCATGGCCACGTTCAAGGG - Intergenic
1175806720 20:61833658-61833680 CTGTGCTTGGTCAGTTATGAGGG - Intronic
1176648440 21:9372750-9372772 TTGTGCTTGGCCAGGCATGGTGG - Intergenic
1176851002 21:13913984-13914006 TTGTGCTTGGCCAGGCGTGGTGG - Intergenic
1177776964 21:25578577-25578599 ATGTGCTTGGCCTGGATTAAGGG - Intergenic
1178211432 21:30537956-30537978 GTGTTCTTGGCCAGGTGTGGTGG + Intergenic
1179254207 21:39700724-39700746 CTGTGTTTGGCCAGGTGTGATGG - Intergenic
1180303844 22:11057519-11057541 CTGGGCTCGGCCAGGTGTGGTGG + Intergenic
1180361827 22:11906739-11906761 TTGTGCTTGGCCAGGCATGGTGG + Intergenic
1181337178 22:22145773-22145795 CTGTCCTTGGCCAGGTGTGGTGG - Intergenic
1181447909 22:22992818-22992840 CTGAGCTTGGCCAGGTTTGGTGG + Intergenic
1181764393 22:25080699-25080721 CTGAAATTGGCCAGGTGTGATGG - Intronic
1182221563 22:28762913-28762935 CTGGGCTGGGCCAGGTGTGGTGG + Intergenic
1182291756 22:29285407-29285429 CTGGTATTGGCCAGGTTTGAAGG - Intronic
1182476681 22:30580318-30580340 CTCTGCTGAGCCAGGATTGAAGG - Intronic
1183908661 22:41062157-41062179 CTGAGCTTGGCCTGGTGTGGTGG - Intergenic
1184539554 22:45111457-45111479 CTGTATTTGGCCAGGTGTGGTGG - Intergenic
1184776776 22:46627361-46627383 CTGGGCTTAGCCAGCTTTGGGGG - Intronic
1185110545 22:48897917-48897939 CTGTGCTTGGGCAGGGGTGGAGG - Intergenic
1185286408 22:50001794-50001816 CTTTGCTCAGCCAGGTTTGCAGG + Intronic
949252494 3:2003698-2003720 CTGTGCTTGGCCAGGCATGGTGG + Intergenic
949358680 3:3208718-3208740 CTGTGGTTGTCAGGGTTTGAGGG + Intergenic
949477460 3:4462205-4462227 CTATGGTTGGCCAGGCTTGGTGG - Intronic
949921200 3:9003187-9003209 CCGTGCCTGGCCGGGTTTGCTGG - Intronic
950217749 3:11171404-11171426 CTGTGCCTGGCCAGGGTTGCAGG + Intronic
950442957 3:13020383-13020405 TTGGGCCTGGGCAGGTTTGAGGG - Intronic
951880689 3:27478695-27478717 CTGTGCCTGGCCTAGTTTGGCGG - Intronic
951958266 3:28283224-28283246 CAGTTCTTGGCCAGGTGTGGTGG + Intronic
953012106 3:39036430-39036452 ATCTGCTTGGCCAGGTGTGGTGG - Intergenic
953448869 3:42990039-42990061 CTGTGCAGGGCCAGGTGTGGTGG + Intronic
954078032 3:48195458-48195480 CTGGGGTTGGCCAGGTGTGGTGG + Intergenic
954301575 3:49703337-49703359 CTGTGCTAGGCCAGATTGGAGGG + Intronic
954366561 3:50149503-50149525 ATTTGCTTGGCCAGGTGTGGAGG + Intergenic
955756029 3:62225939-62225961 CTTTGCTTGGCCAGGCGTGGTGG - Intronic
956066153 3:65399498-65399520 CTGTGCCAGGACAGGGTTGAGGG - Intronic
957591508 3:82205209-82205231 CTGTGGGTTTCCAGGTTTGAAGG + Intergenic
958036544 3:88176163-88176185 CTGGGCTTGGCCAGGCATGGTGG - Intergenic
958686841 3:97408970-97408992 CTGTGTTAGGCAAGGATTGAGGG - Intronic
959054663 3:101555270-101555292 AAGTGCTTGGCCAGGCATGATGG - Intergenic
961162068 3:124735989-124736011 CTGTGCCTGGCCAATTTTCAGGG - Intronic
961899633 3:130198098-130198120 CTGTGCTCAGCCAGATTTAAGGG - Intergenic
962960048 3:140302780-140302802 CTTTGCTAGGCCAGGTGGGAGGG + Intronic
963022385 3:140885087-140885109 CTGTGCCTGGCCAGATCTGATGG + Intergenic
964796438 3:160502808-160502830 CTGTACTTGCCCAGGTTTAAGGG - Intronic
964862769 3:161220741-161220763 CTGTGCTGCTCCAAGTTTGAGGG + Intronic
966577505 3:181519032-181519054 CTGTACTTGGCCGGGTGTGGTGG + Intergenic
966760279 3:183411842-183411864 CTGTGCTTAGCCAGATGTCAAGG - Intronic
967838198 3:193981790-193981812 CTGTCCATGGCCAGCCTTGAAGG - Intergenic
968015385 3:195327639-195327661 CTGCGCCCGGCCAGGTTTTATGG - Intronic
968365704 3:198183368-198183390 CTGTGCTTGGCCACGATGAAAGG - Intergenic
1202738442 3_GL000221v1_random:32234-32256 TTGTGCTTGGCCAGGCATGGTGG + Intergenic
968619535 4:1597544-1597566 CTGTGCTGGGTCAGTTCTGAGGG - Intergenic
972002432 4:34055685-34055707 CTGTGCCTGGCCTGATTTCATGG + Intergenic
973802810 4:54495684-54495706 CTGTTGTTGCCCAGGCTTGAGGG - Intergenic
974159282 4:58116908-58116930 GAATGCTTGGGCAGGTTTGAGGG + Intergenic
975353285 4:73369776-73369798 CTGTTTATGGCCAGATTTGAGGG - Intergenic
977272371 4:94932817-94932839 CTGGACTTGGCTAGGTCTGACGG + Intronic
978803625 4:112778255-112778277 CTGGGATTGGCCAGGTGTGGTGG - Intergenic
979254739 4:118598522-118598544 CTGTGCTTGGCCACGATGAAAGG - Intergenic
979334223 4:119447496-119447518 CTGTGCTTGGCCACGATGAAAGG + Intergenic
979696192 4:123616009-123616031 CTGTGAATGGGTAGGTTTGAAGG - Intergenic
982331100 4:154182973-154182995 CTATGTTTGGCCAGGCATGATGG + Intergenic
985255976 4:188070411-188070433 CTATACTTGGCCAGGTGTGGTGG + Intergenic
1202767475 4_GL000008v2_random:161018-161040 TTGTGCTTGGCCAGGCATGGTGG - Intergenic
985953122 5:3238283-3238305 CTTTGCTTCACCAGGCTTGATGG + Intergenic
986181524 5:5397558-5397580 CTGTTCTAAGCCAGCTTTGAGGG - Intergenic
987342443 5:16950730-16950752 CTTTTCTTGGCCAGGTGTGGTGG + Intergenic
987360292 5:17100146-17100168 CTGAGCGTGGCCAGGTTGGTGGG - Intronic
988562634 5:32294586-32294608 CTATGCTTGGCCAGGTGCGGTGG - Intronic
989246931 5:39265192-39265214 CTGGGCCTGGCCAGGTGTGGTGG + Intronic
989359836 5:40588961-40588983 CTGTCTTTGGCCAGGTGTGGTGG + Intergenic
990294649 5:54388604-54388626 CTGTGCTTGGCCATGCTTGTGGG + Intergenic
990322269 5:54641522-54641544 CTGTGGGTGGCTAGGTTTGTAGG - Intergenic
990902750 5:60770985-60771007 CTGTGGCTGGCCAGGTGTGGTGG - Intronic
991106677 5:62851589-62851611 CAGTGGTTAGCCAGGTTAGAGGG + Intergenic
991343103 5:65633556-65633578 CTGTGCCCAGCCAGATTTGAAGG + Intronic
991688718 5:69206161-69206183 CTGTGCCTGGCCAGATTTGTTGG + Intronic
991979941 5:72220231-72220253 CTGTGCTTGGCCGGGTGTGGTGG + Intronic
992961484 5:81960245-81960267 CTGTGCTTGGCCAGGCGCGGTGG + Intergenic
995520947 5:113004838-113004860 CTGGGCTTGGCCAGGCGTGGTGG + Intronic
997334985 5:133101091-133101113 ATGTGCTTGGTCAGGTTCGGTGG - Intronic
999832707 5:155336082-155336104 CTGTGTTTGGCCAGTGTTTAAGG + Intergenic
999983567 5:156981446-156981468 CTGTTCTTGGCCAGGTGTGGTGG - Intergenic
1002399104 5:178981316-178981338 CTGGGCTTTGCCTGGTTTGCGGG - Exonic
1002700000 5:181117000-181117022 CTGCTCTTGGCCAGGTGTGGTGG + Intergenic
1002860738 6:1077302-1077324 CTGAGCTAGGCCAGGGTTGCTGG + Intergenic
1004078159 6:12364247-12364269 CAGTGCTTGGCCAGATTTGGGGG - Intergenic
1004869750 6:19892963-19892985 AAGTGCTTGGCCAGGTATGGTGG + Intergenic
1005282871 6:24293212-24293234 CAGTGCTGGGCCAGGTGTGGTGG - Intronic
1005617935 6:27593321-27593343 CTGTCCTCGGCCAGGTTGGAGGG + Intergenic
1006228162 6:32558306-32558328 CTGTGCATGGTCAGGGTTGCAGG - Intronic
1006429404 6:33985761-33985783 CTGTGCTGGCCCTGGTGTGAGGG + Intergenic
1006670039 6:35724588-35724610 CTGGCTTTGGCCAGGTGTGATGG + Intronic
1011632588 6:89341448-89341470 TTTTCCTTGGCCAGGTATGATGG + Intronic
1012600524 6:101091774-101091796 CAGTGCTGGGCCAGGTGTGTGGG + Intergenic
1013220323 6:108072344-108072366 ATGTCCTTGGCCAGGTGTGGTGG + Intronic
1013401505 6:109801258-109801280 GTGTGCTTGGCCAGGCGTGGTGG + Intronic
1013541053 6:111109737-111109759 TTGTGGTAGGCCAGGTGTGATGG - Intronic
1013573027 6:111448952-111448974 CTGTAATTGGCCAGGTGTGGTGG - Intronic
1016715585 6:147224136-147224158 CAGGGCTTGGCCAGGTGCGATGG + Intronic
1017121046 6:151024250-151024272 CTGTGCTTGGCCAGGCGCGGCGG + Intronic
1017771753 6:157649764-157649786 CTGGGTATGGCCAGGTTTGGAGG + Intronic
1018329446 6:162711522-162711544 CTGTGTTTGCACAGGTCTGAGGG - Intronic
1018519847 6:164635658-164635680 CTGAGCTGTGCCAGGTTTGAGGG + Intergenic
1019984426 7:4644923-4644945 CTGGGCTTGGCCGGGTGTGATGG - Intergenic
1023309267 7:38867256-38867278 CTGTGGGTGGCCAGGTGTGGTGG + Intronic
1023721811 7:43103453-43103475 CTTTTCTTGGCCAGGTGTGGTGG - Intergenic
1023787166 7:43719253-43719275 CTCTTCTTGGCCAGGTGTGGTGG - Intronic
1024097211 7:45991857-45991879 CTGTGGTGGGCCAGGTCAGAAGG + Intergenic
1024726224 7:52199360-52199382 CTGTTGTTGGCCGGGTTTGGTGG + Intergenic
1025154748 7:56594544-56594566 CTGTGCCTGGCCAGGATTTCTGG + Intergenic
1025949815 7:66135633-66135655 CTTTTCTTGGCCAGGTGTGGCGG + Intronic
1026332383 7:69363993-69364015 CTGTGCTTGGCCAGGTGCCGTGG + Intergenic
1026906728 7:74066996-74067018 CAGTTCATGGCCAGGTGTGATGG + Intronic
1027124219 7:75544566-75544588 GAGTACTTGGCCAGGTTAGATGG - Intronic
1029016068 7:97316486-97316508 CTGTGGTTTTCCAGGCTTGAGGG - Intergenic
1029998665 7:105034517-105034539 CTGGTCTTGGCCAGGTGTGTTGG - Intronic
1030684393 7:112469685-112469707 CTATGGCTGGCCCGGTTTGAGGG - Intronic
1032047223 7:128620487-128620509 CTGTGCTTGGCCATGATGAAAGG - Intergenic
1032164476 7:129534552-129534574 CTGTTCTTGGCCAGGCGTGGTGG - Intergenic
1032825108 7:135561055-135561077 CTATGGTTGGCCAGGTGTGGTGG + Intronic
1034868118 7:154658008-154658030 CTGTGCTTGCCAGGGTTTGGTGG + Intronic
1036774388 8:11600071-11600093 TTGTGCCTGGCCTGGTTTGATGG - Intergenic
1036786620 8:11692272-11692294 CTGTGCTTGAAAAGGTGTGATGG - Intronic
1037391586 8:18398471-18398493 GTTTGTTTGGCCAGCTTTGAGGG + Intronic
1038819352 8:30938069-30938091 TTTTGCTTGGCCAATTTTGATGG + Intergenic
1039525702 8:38214193-38214215 CTGTGCCTGGCCAGGTTTCCAGG + Intergenic
1039720997 8:40164125-40164147 CTGGTTTTGGCAAGGTTTGAAGG + Intergenic
1039835988 8:41256713-41256735 CCGAGCTGGGCCAGGCTTGAGGG - Intergenic
1040523087 8:48194319-48194341 CTGTGCTGTGGCAGGTTTCAGGG + Intergenic
1041303760 8:56438854-56438876 CTGTGCTTGGCCAGGCGCGGTGG + Intronic
1042629448 8:70800774-70800796 CTGTGCCTGGCCAGGTTCTGGGG + Intergenic
1043575371 8:81650460-81650482 CCGTGCCTGGCCAGGTGTGAGGG - Intergenic
1044875571 8:96662704-96662726 CAATGCTTGGCCAGGTGTGGTGG + Intronic
1046777486 8:118179492-118179514 ATGTGGTTGGCCAGGTACGAGGG + Intergenic
1047902762 8:129442075-129442097 CTATCCTTGGCCAGGTGTGATGG + Intergenic
1048150109 8:131885724-131885746 CTGAGCTGGGCCAGGATTCATGG - Intergenic
1049082689 8:140455714-140455736 CTGTGCCTGGCCAGGCATGGTGG - Intronic
1049543647 8:143219661-143219683 CTGGTCTTGGTCAGTTTTGATGG - Intergenic
1049795521 8:144495721-144495743 CTGTGCTTGGCCAGGCGCGGTGG - Intronic
1049829107 8:144688390-144688412 GTGTCCTTGGCCAGGTGTGGTGG - Intergenic
1050539088 9:6654732-6654754 CTGAGTGTGGACAGGTTTGAGGG + Intergenic
1050739227 9:8801424-8801446 CTGTGCTTGGCCAGGTTTGATGG - Intronic
1051403156 9:16705329-16705351 CCGCGCTGGGCCAGCTTTGACGG + Intronic
1052710446 9:32049247-32049269 CTATGCTTGGCCAGGCATGGTGG - Intergenic
1052876380 9:33569744-33569766 TTGTGCTTGGCCAGGTGTGGTGG + Intronic
1053499632 9:38574602-38574624 TTGTGCTTGGCCAGGTGTGGTGG - Intronic
1056587226 9:87936732-87936754 TTGTGCTTGGCCAGGTGTGGTGG - Intergenic
1056609650 9:88116211-88116233 TTGTGCTTGGCCAGGTGTGGTGG + Intergenic
1058919148 9:109596793-109596815 ATGAGCTTGGCCAGGTGTGGTGG + Intergenic
1059180306 9:112206061-112206083 CTGTGCTTGGCCAGGCATGGTGG + Intergenic
1060611803 9:124973408-124973430 ATGTGCTTGGCCAGGTGTGGTGG + Intronic
1060814875 9:126629856-126629878 CTGTGGTTGGCCGGGTGTGGTGG + Intronic
1061667206 9:132167532-132167554 CTTTGCATGGGGAGGTTTGACGG + Intronic
1062564666 9:137158847-137158869 CTGTGCTGTGCCAGGTGTGCTGG - Intronic
1203707173 Un_KI270742v1:62681-62703 TTGTGCTTGGCCAGGCATGGTGG + Intergenic
1203548230 Un_KI270743v1:145891-145913 TTGTGCTTGGCCAGGCATGGTGG - Intergenic
1186156816 X:6734063-6734085 CTTTGCTTGGCCAGGCGTGGTGG - Intergenic
1187760315 X:22576611-22576633 GTGTTCTTGGCCAGGTGTGGTGG + Intergenic
1188557060 X:31424374-31424396 CTGTGATTGGACAAGGTTGAGGG + Intronic
1189930566 X:46004571-46004593 CTTTGCTAGGCCAGGTGTGGTGG + Intergenic
1190847740 X:54209836-54209858 CAGTGCTTGGCCAGGTGCGGTGG - Intronic
1191801129 X:65080638-65080660 CTTTGTTTCTCCAGGTTTGAAGG - Intergenic
1192037249 X:67577136-67577158 TTGTGCTTGCCTAGGGTTGAAGG - Intronic
1192105677 X:68314229-68314251 CTGTGCCTGGCCCGGTTGGGAGG - Intronic
1192520783 X:71798050-71798072 CTTTTCTTGGCCAGGTGCGATGG - Intergenic
1192658391 X:73016587-73016609 CTGGGGTTGGCAAGGTTGGAGGG + Intergenic
1195024535 X:100863017-100863039 CTGTTCTTGGCCTGTTTTCATGG - Intronic
1195554115 X:106201703-106201725 CTGTGCCTGGCCAGTCTTGGGGG + Intronic
1195901961 X:109808425-109808447 TTGTGCTTGGCCAGGCATGGTGG - Intergenic
1197803951 X:130381434-130381456 CTGTGTTTGGCCAGGCATGGTGG - Intergenic
1197821009 X:130540888-130540910 CTGTGCCCAGCCAAGTTTGATGG + Intergenic
1198170932 X:134104559-134104581 CTATTCTTGGCCAGGTGTGGTGG + Intergenic
1199144425 X:144348781-144348803 CTGTGCTCGAGCAGGTATGAAGG - Intergenic
1199764670 X:150932365-150932387 CTGTGCTCAGTCAAGTTTGATGG + Intergenic
1199847167 X:151699923-151699945 CTGGGCTGGGCCTGGTTTGAAGG + Intronic
1200237387 X:154474436-154474458 CTGTGCCCGGCCAGGTGAGATGG + Intergenic