ID: 1050739488

View in Genome Browser
Species Human (GRCh38)
Location 9:8803844-8803866
Sequence CATGTGCAAAACCTATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050739483_1050739488 24 Left 1050739483 9:8803797-8803819 CCTTTTTTTGGCAGAAAAATAAG 0: 1
1: 0
2: 3
3: 54
4: 650
Right 1050739488 9:8803844-8803866 CATGTGCAAAACCTATTTATTGG No data
1050739485_1050739488 -7 Left 1050739485 9:8803828-8803850 CCTATTGCCAAAAAGCCATGTGC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1050739488 9:8803844-8803866 CATGTGCAAAACCTATTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050739488 Original CRISPR CATGTGCAAAACCTATTTAT TGG Intronic
No off target data available for this crispr