ID: 1050742728

View in Genome Browser
Species Human (GRCh38)
Location 9:8841035-8841057
Sequence TCCTCACCACTCTGTAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050742728_1050742733 20 Left 1050742728 9:8841035-8841057 CCATGGCTACAGAGTGGTGAGGA 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1050742733 9:8841078-8841100 TCTTTCTGGGGTAAAATGTGTGG No data
1050742728_1050742731 7 Left 1050742728 9:8841035-8841057 CCATGGCTACAGAGTGGTGAGGA 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1050742731 9:8841065-8841087 ATGGACTATTAAATCTTTCTGGG No data
1050742728_1050742732 8 Left 1050742728 9:8841035-8841057 CCATGGCTACAGAGTGGTGAGGA 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1050742732 9:8841066-8841088 TGGACTATTAAATCTTTCTGGGG No data
1050742728_1050742730 6 Left 1050742728 9:8841035-8841057 CCATGGCTACAGAGTGGTGAGGA 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1050742730 9:8841064-8841086 GATGGACTATTAAATCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050742728 Original CRISPR TCCTCACCACTCTGTAGCCA TGG (reversed) Intronic
900870246 1:5297195-5297217 TCCTCCCCAGTTTGTTGCCATGG + Intergenic
901821158 1:11830255-11830277 TGCTCACCTGTCTGCAGCCAAGG - Intronic
902993238 1:20204251-20204273 TCCTCTGAACTCTGTAGCAAGGG - Intergenic
903756424 1:25664660-25664682 TATTTCCCACTCTGTAGCCAAGG - Intronic
904565278 1:31424959-31424981 TACCCACCACTCAGGAGCCACGG + Intronic
905552851 1:38858279-38858301 ACCTCTCCACTCTGTTGCAAAGG - Intronic
908047942 1:60192174-60192196 TCCTCACAATTCTGTAGGCTAGG - Intergenic
908153635 1:61329825-61329847 CCCTCTCCACCCTTTAGCCAGGG - Intronic
910175393 1:84424943-84424965 GTCTCATCACTCTGTAGGCAGGG + Intergenic
912605071 1:110981665-110981687 TCTTGACTACTCAGTAGCCAGGG - Intergenic
912641405 1:111349341-111349363 TGCTCACTACACTCTAGCCATGG - Intronic
917705584 1:177630926-177630948 TCCTCCCTACTCTGTGGCTATGG - Intergenic
918124973 1:181575246-181575268 TCCCAACCACACTGCAGCCAGGG - Intronic
919827862 1:201516614-201516636 TCCTCAGCCCCCTGTAGCAAAGG - Intergenic
920655455 1:207870965-207870987 TTCTCACCATTCTGGAGGCAAGG - Intergenic
921303184 1:213770010-213770032 TCCTCCCCACTTGGTAGCCCTGG - Intergenic
922250097 1:223841215-223841237 GTCTCACCACTCTGTAGTCCAGG - Intronic
922409295 1:225355135-225355157 TGCTCACCACTCTGGAGGCTGGG + Intronic
922702839 1:227771780-227771802 TCCCCATCACTCTGAAGCCATGG - Intronic
922858307 1:228794058-228794080 TCATCACCTTTCTGAAGCCATGG - Intergenic
922910504 1:229211773-229211795 TCCTCCCCAGCTTGTAGCCAAGG + Intergenic
923120070 1:230981640-230981662 TTCTCTCCACACAGTAGCCAGGG + Intronic
923234089 1:232015575-232015597 TCCCCACCACTGGGCAGCCAGGG + Intronic
923306479 1:232693527-232693549 TCCTCAGCCTTCTTTAGCCAGGG - Intergenic
923370917 1:233311414-233311436 TTCTCCCCGCTCTGGAGCCATGG - Intergenic
924747939 1:246855260-246855282 TCCTCATCTCTGTATAGCCAGGG + Intronic
1067089695 10:43260307-43260329 TCCTCTCCACTCTGCAACCTGGG + Intronic
1067174127 10:43930592-43930614 CACTCTCCACTCTGCAGCCATGG - Intergenic
1067684148 10:48457146-48457168 TCGTCACCTCTCTGTACCCAGGG + Intronic
1071409967 10:85379473-85379495 TCTTCACCACTGTGTTTCCAGGG + Intergenic
1071478958 10:86048624-86048646 GCCTCTCCCCTCTGGAGCCAGGG + Intronic
1072363925 10:94689799-94689821 TAGTCAGCACTCTGTATCCATGG - Intronic
1073291129 10:102413871-102413893 TCCTCCCCTCTCTGTGTCCAAGG + Exonic
1075352310 10:121734775-121734797 TTCTCTCCACTTTGTACCCAAGG + Intergenic
1076331725 10:129675273-129675295 TGCTCACCACACTACAGCCAGGG - Intronic
1076485630 10:130814834-130814856 TTCTGACCACGCTGTACCCAGGG - Intergenic
1076604954 10:131683446-131683468 TCCTGACCACCCTGTTCCCACGG + Intergenic
1078104602 11:8350827-8350849 TGCTGTCCACCCTGTAGCCACGG + Intergenic
1079098022 11:17523339-17523361 TCCCCACCACCCTGGAGCCTGGG - Intronic
1083974282 11:66104870-66104892 TCCTCACTACTCTATTGGCAGGG + Intronic
1084296921 11:68218289-68218311 GCCTCAACACTCTGTCCCCAGGG - Intergenic
1086412718 11:86558491-86558513 TCATCACCACTCAGAAGCAATGG + Intronic
1089078932 11:115760400-115760422 TCCACACCACCCTGCACCCAGGG + Intergenic
1089377319 11:118003722-118003744 GGTTCACCACTCTGTACCCAGGG - Intergenic
1089658814 11:119972294-119972316 TTCTCACCACTCTGGAGGCCTGG - Intergenic
1089739414 11:120572022-120572044 TTCTCACCATTCTGGAGGCAGGG + Intronic
1090794771 11:130125246-130125268 TCCTCTCCACTCTGGTCCCAGGG + Intronic
1091213756 11:133886878-133886900 ACCTCACCAGTGTGGAGCCAAGG - Intergenic
1092907409 12:13114662-13114684 GCCTCACCACTCCCTAGCCGTGG + Intronic
1093459431 12:19394950-19394972 TTCTCATCACTCTGTTGCCCAGG - Intergenic
1096139244 12:49228876-49228898 TCCTCTCCACTCTGCAGATAAGG + Intronic
1096988265 12:55776609-55776631 TACTCAGCCCTCTGTATCCATGG - Intronic
1097078346 12:56411298-56411320 ACATCACCACACTGTAGCCTAGG + Intergenic
1098570962 12:71986778-71986800 CCTTCAGCACTCTGTAGTCAGGG + Intronic
1102432676 12:112895938-112895960 ACCTCAACTCTCTGTAGCCCTGG - Intronic
1104638542 12:130452680-130452702 TCCTCCCCACACAGTGGCCAGGG + Intronic
1105629571 13:22148895-22148917 CCCTCACCACACTGGATCCAGGG - Intergenic
1105717423 13:23081303-23081325 TCTTCCTCACCCTGTAGCCAGGG + Intergenic
1106103826 13:26717114-26717136 TCCTCACCACTGGGAAGCCCTGG - Intergenic
1106558298 13:30828594-30828616 TCCTCCCAACTGTGTGGCCAAGG - Intergenic
1109307138 13:60653506-60653528 TCCTTCCCAGTCTGTACCCATGG + Intergenic
1112487490 13:99833440-99833462 TCCACACCATTATGTAGCTATGG - Intronic
1112655292 13:101445939-101445961 CCCTCATCACTCTGTGGCCTTGG + Intergenic
1112742781 13:102494084-102494106 TCCTCACAATTCTGGAGGCAGGG - Intergenic
1114028666 14:18555338-18555360 TCCTGAGCAGTCTTTAGCCATGG - Intergenic
1114485484 14:23059051-23059073 TCTCCACCACCCTGGAGCCAAGG - Exonic
1114949240 14:27727104-27727126 TCCTCTCCACTCTTTAGGCTGGG + Intergenic
1118376527 14:65182110-65182132 TTATCACCAGGCTGTAGCCATGG + Intergenic
1119749779 14:77068949-77068971 TCCTCTCCACTCTCTCTCCAAGG + Intergenic
1121552993 14:94816199-94816221 TCCTCACCTCTCTCTTCCCATGG - Intergenic
1121733484 14:96202432-96202454 TCCTCACCACTCAGTCTCCTTGG - Intergenic
1121740208 14:96246503-96246525 TTCTCACCCCTCTGTGGCCAGGG - Intronic
1121757747 14:96417140-96417162 TCCTGGCCCCTCTGTAGCCCTGG - Intronic
1121774425 14:96581383-96581405 ACCTCACCAGTCTGTAGCGATGG - Intergenic
1121883252 14:97519036-97519058 AGCCCACCACTCTGAAGCCATGG - Intergenic
1122803597 14:104245319-104245341 TCCTCACCTGTCTGTAGCTCGGG - Intergenic
1202883476 14_KI270722v1_random:82967-82989 TCCTCACCACATTATAGCTATGG + Intergenic
1125972792 15:43925703-43925725 TCCTCACTACACTTCAGCCATGG + Intronic
1126933511 15:53680982-53681004 TGCTCACCACTCCCAAGCCAAGG + Intronic
1128946524 15:71826537-71826559 TGTTTACCACTCTGTAGCCACGG + Exonic
1129228177 15:74181848-74181870 CCCTCCCCACTTTGTAGCAAGGG - Intronic
1131372514 15:91894567-91894589 TCCCCAGCACTGTGTTGCCATGG + Intronic
1134093729 16:11405233-11405255 TCCTCTCCACCGTGTAGCCCTGG - Intronic
1139449326 16:67017256-67017278 GCCTCAGCCCCCTGTAGCCATGG + Intergenic
1140321773 16:73959511-73959533 TCTCCACCACACAGTAGCCAGGG - Intergenic
1141161576 16:81632724-81632746 ACCTCCCAGCTCTGTAGCCAGGG - Intronic
1142829948 17:2541420-2541442 TCCTCACCACTCTGTTGCTGAGG + Intergenic
1143200309 17:5108919-5108941 TCCTCACCACTCTTTGGGAAAGG + Exonic
1147556801 17:41484774-41484796 TGTTCAACACTCTGAAGCCAGGG + Intergenic
1148137764 17:45306136-45306158 TCCTCACAACTCTGTGAGCAAGG + Intronic
1148158528 17:45436976-45436998 TCCTCACCCCTCTACAGACAGGG - Exonic
1148227732 17:45910728-45910750 TGCTCACCACACTGTAGTCATGG + Intronic
1148905263 17:50907879-50907901 CCATCACCACACTGGAGCCAGGG + Intergenic
1150389945 17:64784375-64784397 TCCTCACCCCTCTACAGACAGGG - Intergenic
1151498062 17:74471504-74471526 TTGTCACCACTCTATAGACAAGG + Intronic
1154143278 18:11844484-11844506 TGCTCTCCATTCTGTGGCCATGG + Intronic
1155025077 18:21933989-21934011 TCATTTCCACTCTGCAGCCAGGG + Intergenic
1155084690 18:22446537-22446559 TCCTCCTCACCCTGTTGCCATGG - Intergenic
1155738290 18:29252012-29252034 TATTCTCCACTCTGTAACCAGGG - Intergenic
1155915674 18:31554710-31554732 TTCTCACCAATCTCTAGCCAAGG - Intergenic
1156865376 18:41883550-41883572 TCCACACCTCTCTGTAGAAATGG - Intergenic
1157152400 18:45231243-45231265 TCATCACCACTCTCTAGCCTGGG - Intronic
1157281057 18:46346644-46346666 TCCTCACCACTCTGTGACACTGG - Intronic
1157472923 18:48003485-48003507 TCCACACCCCTCTGTATCAACGG - Intergenic
1157529735 18:48410288-48410310 TCCCCACCCCTCTGGAGCCTTGG + Intronic
1158383369 18:56960821-56960843 TCCTAACCACTTAGTAGCCAGGG + Intronic
1160015625 18:75138229-75138251 TTCTCACCATTCTGGAGGCAGGG + Intergenic
1161604299 19:5206363-5206385 TCCTCCCCGCTCTGCAGCCTGGG - Exonic
1162385313 19:10357472-10357494 TCTTCCCCACTCTGCAGCCTGGG + Intronic
1162787631 19:13045617-13045639 TGCTCAGCAGTCTGTTGCCAGGG + Intronic
1163546846 19:17945762-17945784 TCCTCAGCTCTGTGTAGTCAGGG + Intergenic
1163795141 19:19333679-19333701 TCCTTTCCAGTCTGTGGCCATGG - Intronic
1166190410 19:41173007-41173029 TACTCACCACTCTCCGGCCAGGG + Intergenic
1166676115 19:44742089-44742111 TCCTCCCCACCCTGGAGCCTTGG - Intergenic
925798469 2:7572354-7572376 TCCTCACCATTGTGTAGGGAGGG - Intergenic
926469353 2:13234294-13234316 TCATGCCCACTCTGAAGCCAGGG + Intergenic
927131811 2:20066427-20066449 TCCTCACCACTTGGCAGCCTGGG - Intergenic
927367207 2:22311500-22311522 TCCTCACCATGCTGAAGCCTGGG - Intergenic
928036283 2:27826793-27826815 TCATTCCTACTCTGTAGCCATGG + Intronic
928447554 2:31346880-31346902 TCCTCTGCATTCTGTAGCCCAGG + Intronic
928783353 2:34851737-34851759 TTCTCAGCAGGCTGTAGCCAAGG + Intergenic
929045302 2:37783409-37783431 GTCTCACCACTCTGTTGCCCAGG + Intergenic
930498170 2:52175466-52175488 TGCTCACCACACTATAGCCCTGG - Intergenic
930531352 2:52592330-52592352 TCCTCTCTACTGTGCAGCCAAGG + Intergenic
930605395 2:53487891-53487913 TCCACAACTCTCTGTAGGCAGGG - Intergenic
934546883 2:95225000-95225022 TCCTCACCGTTCTGGAGCCTAGG - Intronic
938722416 2:134078339-134078361 TCCTCTCCACTATGTACCCACGG - Intergenic
940767751 2:157808327-157808349 TCCACACCAAAGTGTAGCCAAGG - Intronic
946010195 2:216558307-216558329 TCCTGACCCCTCTGTAGACGTGG + Intronic
946722686 2:222627160-222627182 TTCTCCCCTCTCTGTATCCATGG + Intronic
947689080 2:232117972-232117994 TCCTCACAAGGCTGTAGTCAAGG + Intronic
948131735 2:235605879-235605901 TCACCACCACACTGCAGCCAAGG - Intronic
1170374050 20:15680340-15680362 TCCTCACCAAACTGTCACCAAGG - Intronic
1170800662 20:19587447-19587469 ACCTCACAACCCTGTAGCCATGG + Intronic
1171207115 20:23289763-23289785 TCCTCAGCCCTTTGTAGCAATGG + Intergenic
1173670925 20:44798486-44798508 CTCTCCCCACTCTGTAGTCAGGG + Intronic
1174103428 20:48144757-48144779 TCCTAACCACTGGGTAGCCAAGG - Intergenic
1176143962 20:63557276-63557298 ACCTCACCAGCCTGCAGCCAGGG - Intergenic
1176204984 20:63883411-63883433 TCATCACCATGCTGTAGTCAGGG - Intronic
1176363480 21:6018072-6018094 TTCTCACCTCTCTGTACCTAAGG + Intergenic
1179138450 21:38700886-38700908 TCCTCACAACTCTGGAGGCTGGG + Intergenic
1179760038 21:43520473-43520495 TTCTCACCTCTCTGTACCTAAGG - Intergenic
1179822382 21:43944233-43944255 CCCTCGCCACTCTGGAGCGATGG + Intronic
1180009946 21:45042915-45042937 TTGTCCCCACTCTGTAGCCCTGG - Intergenic
1180013119 21:45064365-45064387 TGCCCACCACTCTGCAGCTAAGG - Intergenic
1180101351 21:45588648-45588670 TCCTCTCCAGACAGTAGCCAGGG + Intergenic
1180452786 22:15482388-15482410 TCCTGAGCAGTCTTTAGCCATGG - Intergenic
1180957486 22:19747431-19747453 TCCTCACACCTCTGCAGCCTGGG - Intergenic
1182073652 22:27480329-27480351 TCCTCACCACAGTCTACCCACGG + Intergenic
1183390100 22:37540816-37540838 CCATCACCACTCTGTAGCCCTGG + Intergenic
1183992470 22:41607083-41607105 TCCTCTCCTCTCTGTTCCCATGG - Intronic
1184180761 22:42823175-42823197 TCCTCAGCCCTCTGTATCCAGGG - Intronic
951480222 3:23153009-23153031 TTCTCACAATTCTGGAGCCAGGG + Intergenic
952321924 3:32285719-32285741 TCAACACAACTCTGTTGCCAAGG - Intronic
954363214 3:50133321-50133343 TCCTCCCCACTGTGTCCCCAGGG + Intergenic
954390026 3:50263836-50263858 TCCTCAACCCTCTGTGCCCAGGG - Intergenic
954637533 3:52079369-52079391 TCCTCACCAGGCTGGAGACAAGG + Intronic
954730727 3:52659445-52659467 TCCTCCCCACTCTGTTGCCCAGG + Intronic
956753654 3:72364855-72364877 TACTCAACACTCTGCAGTCAAGG - Intergenic
957329535 3:78743779-78743801 TCTTTACCACTCTGCAACCAAGG - Intronic
958863121 3:99468483-99468505 CACTCATCACTCTTTAGCCATGG + Intergenic
962082758 3:132157852-132157874 TTCTCACCATTCTGGAGCCTGGG - Intronic
962948002 3:140189927-140189949 TTCTCACCGCTCTGGAGCCTGGG + Intronic
969477473 4:7429708-7429730 ACCCCACCACTCTGTGGCCTTGG - Intronic
971318056 4:25583655-25583677 GTCTCACTACTCTGGAGCCAGGG + Intergenic
971318189 4:25584618-25584640 GCCTCACTACTCTGGAGCCAGGG + Intergenic
974128759 4:57728660-57728682 TCCTCACCACTGTATCTCCAGGG - Intergenic
974168657 4:58237524-58237546 TCCTCCCCTCTCTGGAACCATGG - Intergenic
974260233 4:59517657-59517679 TCAGCTCCTCTCTGTAGCCAGGG + Intergenic
974910355 4:68110368-68110390 TCCTCCCCAGTGTTTAGCCATGG + Intronic
975968765 4:80008514-80008536 TACTCACCACTTTGCAGCAAAGG + Exonic
976913107 4:90333215-90333237 TCCTCACCTCTCTGTGGAAAGGG + Intronic
978863064 4:113474368-113474390 TTCTCTCCACTGTGTAACCAAGG + Intronic
980565876 4:134539940-134539962 CCCTGACCACTCTTTACCCATGG + Intergenic
980591224 4:134891714-134891736 TCAGGACCACTCTGTGGCCATGG + Intergenic
982112769 4:152071813-152071835 TTCTCCCCACTTTGTAGTCAAGG - Intergenic
987164046 5:15174763-15174785 AACTCACCACTCTGTAGGGAAGG + Intergenic
987213585 5:15709748-15709770 TCCTCACCATTCTGGAGGCTGGG + Intronic
989172615 5:38487833-38487855 TCCTCACCACTCAGCCTCCAAGG + Intronic
993879100 5:93342228-93342250 TCCACAGCACTCTGTACACAAGG + Intergenic
996541231 5:124631502-124631524 TCCTCACCACTCTCCAGAGAAGG - Intergenic
996726312 5:126675791-126675813 GTCTCACCACTCTGTTGCCCAGG + Intergenic
998234062 5:140382633-140382655 TCCTCTCCAGTCTGTAGCTGTGG + Intergenic
998372027 5:141667997-141668019 TCTTCACCGCACTGTAGCCTGGG + Intronic
998797242 5:145833660-145833682 TCCTCACTCCTCTGTGACCAGGG + Intronic
999195381 5:149778254-149778276 TCCTCACCACTCTTGGGTCAGGG - Intronic
999451724 5:151683336-151683358 TGCTCACCACTTAGTATCCATGG + Intronic
1001448797 5:171808052-171808074 TGCTTACCACTCAGTAACCATGG + Intergenic
1002575344 5:180170937-180170959 TCCTCCCCACTCTCCAGGCAGGG - Intronic
1002690518 5:181046592-181046614 TCTTCAGCAGTCTGTAGTCAAGG + Intronic
1005856906 6:29869708-29869730 TCCTCACCCCTATGATGCCACGG + Intergenic
1006453312 6:34117789-34117811 TCCTCACCACCCAGCACCCAAGG + Intronic
1010384430 6:75262614-75262636 GTCTCACCACTCTGTCGCCCAGG - Intronic
1010876287 6:81110737-81110759 TCCTCAGCACTCTTGAGCCCAGG - Intergenic
1012103024 6:95115630-95115652 TCCTGTCCACACTGTAGCAAAGG + Intergenic
1014289536 6:119541730-119541752 TTCTCACAACTTTGTATCCAGGG - Intergenic
1014640123 6:123899191-123899213 CCCTCACAACTCAGTAGTCATGG - Intronic
1024944270 7:54792887-54792909 TCCTCACTTCCCAGTAGCCAAGG + Intergenic
1026938435 7:74272591-74272613 TCCTCTCTCCTCTGAAGCCAGGG - Intergenic
1029665104 7:101989967-101989989 GCCTCACCACAGTGGAGCCATGG + Intronic
1032723572 7:134570680-134570702 TCCACACCACTCTGCAGCCCTGG - Intronic
1033350487 7:140558264-140558286 ACCTCATCACTCTGCAGCAAGGG + Intronic
1036708526 8:11062267-11062289 TCCTCCCCACTCTCTGGCCTTGG - Intronic
1038451923 8:27645165-27645187 TCCCCAACACTCCCTAGCCATGG + Intronic
1039379204 8:37068943-37068965 GTCTCACCACTCTGTTGCCCAGG - Intergenic
1041712437 8:60906618-60906640 CCCTCTCCACCCTCTAGCCAGGG - Intergenic
1042642731 8:70953849-70953871 TTCCCACCTCTCTGTAACCATGG - Intergenic
1045185876 8:99837542-99837564 TCCTCAAAACTTTGTAGTCAGGG + Intronic
1046420874 8:113981013-113981035 TTCTCACCCCTGTGTAGGCAAGG + Intergenic
1047534583 8:125708028-125708050 TACTCACCACTCTGTCCTCAGGG - Intergenic
1047705990 8:127500094-127500116 TCCTCAGCCCACTGGAGCCAAGG + Intergenic
1048342582 8:133552181-133552203 ACCACACCACTCTGTGTCCAGGG + Intronic
1049372681 8:142275210-142275232 GCCCCTCCACTCTGTGGCCACGG + Intronic
1050150492 9:2614969-2614991 TCCCCTCCACTCTGCAGACATGG + Intergenic
1050742728 9:8841035-8841057 TCCTCACCACTCTGTAGCCATGG - Intronic
1051355471 9:16236072-16236094 TGCTCACCACTCTGCATCCCAGG + Intronic
1053797100 9:41736534-41736556 ACCTCACTGCTCTGTAGCCTGGG - Intergenic
1054185514 9:61948615-61948637 ACCTCACTGCTCTGTAGCCTGGG - Intergenic
1054467837 9:65509428-65509450 ACCTCACTGCTCTGTAGCCTGGG + Intergenic
1054652999 9:67639878-67639900 ACCTCACTGCTCTGTAGCCTGGG + Intergenic
1054708170 9:68483973-68483995 TCTTCGCCACGCTGTAGACATGG - Exonic
1056372894 9:85975662-85975684 TACTCATCTCTCTGTATCCATGG - Intronic
1057743046 9:97728943-97728965 TCTTCCCAACTCTGTATCCAGGG + Intergenic
1059008415 9:110429596-110429618 ACCACACCACTCTCAAGCCAAGG - Intronic
1059017837 9:110540896-110540918 ACCTCTCAAATCTGTAGCCAAGG - Intronic
1059113956 9:111584053-111584075 TCCATACCACTTTGGAGCCATGG - Intronic
1061218543 9:129235789-129235811 CCCTCACCACTGTGTTGTCAGGG + Intergenic
1186593096 X:10952499-10952521 TCCTCAAGACTTTGTAACCAGGG + Intergenic
1190339515 X:49285948-49285970 TCCTCCCCTCTCTGTGGCCTGGG + Exonic
1190835022 X:54092517-54092539 CCCCCACCACTCTGTCGCCCAGG - Intronic
1192181560 X:68919108-68919130 CCCCCACCACCCTGTAGCCAGGG - Intergenic
1192955642 X:76067592-76067614 TCTTCCCCACTCTGTTGCAATGG + Intergenic
1197879294 X:131148294-131148316 TTCTCACCACTTTGTATCAAAGG + Intergenic
1198307395 X:135396656-135396678 GTCTCACCTCTCTGTAGCCTTGG + Intergenic