ID: 1050742733

View in Genome Browser
Species Human (GRCh38)
Location 9:8841078-8841100
Sequence TCTTTCTGGGGTAAAATGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050742728_1050742733 20 Left 1050742728 9:8841035-8841057 CCATGGCTACAGAGTGGTGAGGA 0: 1
1: 0
2: 0
3: 19
4: 214
Right 1050742733 9:8841078-8841100 TCTTTCTGGGGTAAAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050742733 Original CRISPR TCTTTCTGGGGTAAAATGTG TGG Intronic
No off target data available for this crispr