ID: 1050744020

View in Genome Browser
Species Human (GRCh38)
Location 9:8857249-8857271
Sequence CCTTTAAAAAAGGCGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050744012_1050744020 0 Left 1050744012 9:8857226-8857248 CCTCCTTAAAACAGTAATCCCTG 0: 1
1: 0
2: 0
3: 6
4: 145
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744009_1050744020 16 Left 1050744009 9:8857210-8857232 CCTCACCGTAGTCAGCCCTCCTT 0: 1
1: 0
2: 0
3: 11
4: 79
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744006_1050744020 19 Left 1050744006 9:8857207-8857229 CCCCCTCACCGTAGTCAGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744010_1050744020 11 Left 1050744010 9:8857215-8857237 CCGTAGTCAGCCCTCCTTAAAAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744011_1050744020 1 Left 1050744011 9:8857225-8857247 CCCTCCTTAAAACAGTAATCCCT 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744007_1050744020 18 Left 1050744007 9:8857208-8857230 CCCCTCACCGTAGTCAGCCCTCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744013_1050744020 -3 Left 1050744013 9:8857229-8857251 CCTTAAAACAGTAATCCCTGCCT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data
1050744008_1050744020 17 Left 1050744008 9:8857209-8857231 CCCTCACCGTAGTCAGCCCTCCT 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1050744020 9:8857249-8857271 CCTTTAAAAAAGGCGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050744020 Original CRISPR CCTTTAAAAAAGGCGGTGGC AGG Intronic
No off target data available for this crispr