ID: 1050746934

View in Genome Browser
Species Human (GRCh38)
Location 9:8887064-8887086
Sequence CAGTTAACTCACATGTAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3966
Summary {0: 1, 1: 1, 2: 27, 3: 461, 4: 3476}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050746934_1050746936 13 Left 1050746934 9:8887064-8887086 CCATTTTACATGTGAGTTAACTG 0: 1
1: 1
2: 27
3: 461
4: 3476
Right 1050746936 9:8887100-8887122 TTCAGTAAGTGACTTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050746934 Original CRISPR CAGTTAACTCACATGTAAAA TGG (reversed) Intronic
Too many off-targets to display for this crispr