ID: 1050746934 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:8887064-8887086 |
| Sequence | CAGTTAACTCACATGTAAAA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3966 | |||
| Summary | {0: 1, 1: 1, 2: 27, 3: 461, 4: 3476} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050746934_1050746936 | 13 | Left | 1050746934 | 9:8887064-8887086 | CCATTTTACATGTGAGTTAACTG | 0: 1 1: 1 2: 27 3: 461 4: 3476 |
||
| Right | 1050746936 | 9:8887100-8887122 | TTCAGTAAGTGACTTGCCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050746934 | Original CRISPR | CAGTTAACTCACATGTAAAA TGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||