ID: 1050748786

View in Genome Browser
Species Human (GRCh38)
Location 9:8911319-8911341
Sequence AAGTGCCAAGGCAATTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050748784_1050748786 9 Left 1050748784 9:8911287-8911309 CCTCGTATTTAAGGTCAATTGAT 0: 1
1: 0
2: 32
3: 185
4: 689
Right 1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG No data
1050748781_1050748786 21 Left 1050748781 9:8911275-8911297 CCAGAAATAAACCCTCGTATTTA 0: 1
1: 16
2: 136
3: 777
4: 2526
Right 1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG No data
1050748783_1050748786 10 Left 1050748783 9:8911286-8911308 CCCTCGTATTTAAGGTCAATTGA 0: 1
1: 0
2: 12
3: 56
4: 326
Right 1050748786 9:8911319-8911341 AAGTGCCAAGGCAATTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050748786 Original CRISPR AAGTGCCAAGGCAATTCAGT TGG Intronic
No off target data available for this crispr