ID: 1050755783

View in Genome Browser
Species Human (GRCh38)
Location 9:9001508-9001530
Sequence CTGTGGTGCCATTTATCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050755783_1050755789 14 Left 1050755783 9:9001508-9001530 CCTCTAGATAAATGGCACCACAG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1050755789 9:9001545-9001567 AATACTTAAAGCTCTGGATCGGG No data
1050755783_1050755787 8 Left 1050755783 9:9001508-9001530 CCTCTAGATAAATGGCACCACAG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1050755787 9:9001539-9001561 AGGTTCAATACTTAAAGCTCTGG No data
1050755783_1050755788 13 Left 1050755783 9:9001508-9001530 CCTCTAGATAAATGGCACCACAG 0: 1
1: 0
2: 0
3: 8
4: 140
Right 1050755788 9:9001544-9001566 CAATACTTAAAGCTCTGGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050755783 Original CRISPR CTGTGGTGCCATTTATCTAG AGG (reversed) Intronic
900786016 1:4651120-4651142 CTCTGAGGCCATTTATCTAATGG - Intergenic
901059136 1:6463879-6463901 CTGTGCTGCTAGTTCTCTAGGGG - Intronic
902676438 1:18011826-18011848 ATGTGATGCCAGTTTTCTAGGGG + Intergenic
904095220 1:27971705-27971727 CTGTGGGTCCATTCATCAAGGGG - Exonic
904303068 1:29568572-29568594 CTGTGTAGGCATTTGTCTAGAGG - Intergenic
916622861 1:166519913-166519935 ATGTGTTGGCATTTTTCTAGGGG + Intergenic
917140752 1:171833020-171833042 CTGTAGTTCCAGTTATCTTGAGG - Intergenic
917522151 1:175757002-175757024 CTGAGGTCCCATATCTCTAGGGG + Intergenic
919417111 1:197324720-197324742 ATGTGGAGCCATATATATAGTGG - Intronic
919654537 1:200184653-200184675 CTGTGGTCCCATCTATTCAGGGG - Intergenic
920778816 1:208968076-208968098 CTATGTTGCCATTTATGGAGAGG + Intergenic
920864542 1:209740947-209740969 CTGTGGTCCCATCTCTCTGGAGG - Intergenic
1064858736 10:19801289-19801311 CTGTGGTCCCAGCTACCTAGGGG + Intergenic
1065161324 10:22925800-22925822 ATGTTTTTCCATTTATCTAGGGG - Intergenic
1071149925 10:82621952-82621974 CTGTGGTGACATGTAACTTGAGG - Intronic
1072582939 10:96755902-96755924 CTGTGGTCCCAACTATCTGGGGG + Intergenic
1072921089 10:99577876-99577898 CTGTGGTCCCAGTTACCTGGGGG - Intergenic
1078518933 11:12047998-12048020 CTGTGGTCACATGTAGCTAGTGG - Intergenic
1085795110 11:79532319-79532341 ATCAGGAGCCATTTATCTAGGGG - Intergenic
1087278414 11:96183518-96183540 CTGTGGTCCCAGTTATCAGGAGG - Intronic
1089377591 11:118005570-118005592 AGGTGGTGCCATTTATCAGGTGG - Intergenic
1089997735 11:122924972-122924994 CTTTGATGCCATTTATCTTCAGG - Exonic
1095360872 12:41337303-41337325 CAGTGGTCCCATTTCTCGAGTGG - Intronic
1099048471 12:77753732-77753754 AAGTGGTACCATTTATCAAGTGG + Intergenic
1100365515 12:93916765-93916787 CTGTGGTCCCAGCTATCGAGAGG + Intergenic
1102132899 12:110546804-110546826 CTATGTTGCCATTTTTCTGGTGG - Intronic
1103551744 12:121742977-121742999 CTGTGGTGGTATTTATTTGGAGG + Intronic
1104337721 12:127915745-127915767 CATTGATGCCATTTCTCTAGTGG - Intergenic
1109723745 13:66312486-66312508 CTGTGGTGCCAGTTACTCAGGGG + Intronic
1109788696 13:67218242-67218264 CTGTGATGGCATTCATCTGGAGG + Intronic
1110667494 13:78135184-78135206 CCTTGGTGCCATTTTGCTAGAGG + Intergenic
1111140509 13:84112390-84112412 CTATAGTGCCAGTTATCAAGAGG - Intergenic
1111146895 13:84194241-84194263 GTGTGGTGCCATTTGTCAAATGG + Intergenic
1113103362 13:106745567-106745589 ATGTGCTCCCATTAATCTAGGGG - Intergenic
1117726681 14:58681615-58681637 CTGTGGTCCCAGCTATTTAGGGG + Intergenic
1120366544 14:83578572-83578594 ATGTGTAGCCATGTATCTAGTGG - Intergenic
1121133986 14:91478055-91478077 ATGTGGAGCCAGTAATCTAGTGG - Intronic
1122570655 14:102697394-102697416 CTGTGCTGCCTTTTATCTTGTGG + Intronic
1125936596 15:43641813-43641835 CTGTGGTCCCAGTTACCCAGAGG - Intronic
1125949320 15:43737990-43738012 CTGTGGTCCCAGTTACCCAGAGG - Intergenic
1127294932 15:57600953-57600975 CTGTGGTCCCAGCTATTTAGGGG + Intronic
1127537003 15:59899582-59899604 CTGTGCTGCCATTTAATTTGGGG - Intergenic
1128320674 15:66691709-66691731 CTCTGGTCCCTTTTATCTGGGGG + Intergenic
1128433296 15:67620491-67620513 CTGTGGTTTCATTTATCTATTGG - Intronic
1133915906 16:10109669-10109691 CTGTTGTGCCATTTATTAAATGG - Intronic
1134541756 16:15072672-15072694 CTGTGGTCCCAGCTATCGAGAGG + Intronic
1140379321 16:74472025-74472047 CTGTAGTTCCAGTTACCTAGGGG - Intronic
1141336071 16:83156591-83156613 CCATGGTGCCTTTTATCTGGAGG - Intronic
1144941203 17:18942501-18942523 CTGTGGTCCCAGCTACCTAGGGG + Intergenic
1150906335 17:69341975-69341997 CTTTGGTACCATTTATCCTGGGG + Intergenic
1153280871 18:3412679-3412701 CTGTGGTTCCTTATATCGAGTGG + Intronic
1158085551 18:53647162-53647184 CTCTGGTTTCATTTAGCTAGTGG - Intergenic
1160595961 18:79974599-79974621 CTGTGGTCCCAGTTACTTAGAGG - Intronic
1162507963 19:11098536-11098558 CTGTAGTCCCATTTATTTGGGGG + Intronic
1165103886 19:33457306-33457328 CTGTGGTGCCAGTTATTTGGGGG + Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1168306456 19:55438611-55438633 CTGTGGTGCAGATTATCTGGGGG + Intronic
927603256 2:24462981-24463003 CGATGGTGCCATTTATGGAGAGG + Intergenic
927947040 2:27141407-27141429 CTGTGGTCCCAGCTATCTGGTGG - Intergenic
935783933 2:106532045-106532067 CTATGGTTGCATTTATCAAGAGG - Intergenic
938410184 2:131057191-131057213 CTGTGTTTTCATTTTTCTAGGGG - Intronic
940626843 2:156186198-156186220 CTGTGGTCCCAGTTACTTAGGGG - Intergenic
941056032 2:160789788-160789810 CTGCAGTGCCATTTATGTAATGG + Intergenic
941129703 2:161631735-161631757 CAGAAGTGCCATTTATATAGTGG + Intronic
944398719 2:199300627-199300649 CTGTGATTCCATTTACCTATAGG + Intronic
945820494 2:214658713-214658735 TTGTGGTGCCAGTTTTCAAGGGG + Intergenic
1168768877 20:401241-401263 CAGTGGTCCCATTTATCCAGGGG + Intergenic
1171187574 20:23133760-23133782 CTGTGGTGCCGGTTATCAACCGG + Intergenic
1174245475 20:49176392-49176414 CTGCGGTCTGATTTATCTAGAGG + Intronic
1175505369 20:59480371-59480393 GTGTGGTGGCGTTTGTCTAGTGG - Intergenic
1177536962 21:22440565-22440587 GTGTGGTGCCATGTACCTATAGG + Intergenic
1180856440 22:19048810-19048832 CTTTGATGCCATTACTCTAGTGG - Intronic
1182638815 22:31750523-31750545 CAGAGGTGCCATTTATTTAGTGG - Intergenic
949745390 3:7285716-7285738 CTGTGATGCCAATTGTCTATTGG + Intronic
950463342 3:13138639-13138661 CTGTGGTGCCCCTGAACTAGAGG - Intergenic
950991241 3:17440492-17440514 CTGTGGTCCCAGCTACCTAGGGG + Intronic
951532666 3:23712371-23712393 TCATGGTGTCATTTATCTAGAGG + Intergenic
953874301 3:46657060-46657082 CTATGGTTCCATCTATCAAGAGG + Intergenic
955594188 3:60570995-60571017 TGGTTGTGCCATTTATTTAGTGG - Intronic
956397371 3:68840329-68840351 CTGTGGTCCCAGTTATATGGAGG - Intronic
960157658 3:114313151-114313173 TTGTGGTGCGATTTATATACAGG - Intergenic
961999931 3:131285244-131285266 CTCTGGATCCATTTATATAGGGG + Intronic
962432215 3:135330035-135330057 CTGTAGTCCCAGCTATCTAGAGG - Intergenic
963005587 3:140723711-140723733 CTGTGGTGCCATTTATGCTCTGG + Intergenic
964115484 3:153132477-153132499 CTGTGGTCCCACCTATTTAGGGG - Intergenic
970802369 4:19988789-19988811 CTGTGGTGCCAGCTACTTAGGGG - Intergenic
970966173 4:21930677-21930699 CTGTGTTGAGATTTATCAAGTGG - Intronic
971790144 4:31159697-31159719 TTGGGGTGCCATTCATTTAGAGG - Intergenic
974271835 4:59660013-59660035 CTGTGGTGCCAGTTGTCAAAGGG - Intergenic
974923778 4:68273571-68273593 CTGTGGTTCCCTTTGTCAAGAGG - Intergenic
975066559 4:70073350-70073372 CTGTGGTGCTACTTATCTGGGGG - Intergenic
975655323 4:76635613-76635635 CTGTTGTTCCATTTCTCCAGAGG - Intronic
975765353 4:77661801-77661823 CTGGGGTGCCATTTCCATAGAGG + Intergenic
976478761 4:85514546-85514568 CTGTGGGGCCTTTTCTCCAGTGG - Intronic
977912279 4:102551238-102551260 CTGTGGTGCCATGTAACCTGGGG - Intronic
978516621 4:109575558-109575580 TTGTGCTGCCATTTAATTAGTGG + Intronic
981764228 4:148229616-148229638 CTGTGGTAACATGTATCTATGGG - Intronic
983443807 4:167822895-167822917 CTGAGGTGTCTTTTATCTATAGG + Intergenic
986023696 5:3829347-3829369 CTGTGGTGGCATTGCTTTAGTGG + Intergenic
991574437 5:68088166-68088188 CTGTGTTGCATTTTCTCTAGGGG + Intergenic
995064341 5:107843378-107843400 CTGTGCTGCCATTGATGTTGTGG - Intergenic
995591182 5:113701326-113701348 GGGTGGTGCCATTTACTTAGGGG - Intergenic
996198360 5:120638284-120638306 CTGTGATGCCATTTCTATATAGG - Intronic
998925296 5:147117020-147117042 CTGTGATCACATTTATCTATTGG + Intergenic
1000774615 5:165403582-165403604 CTGTGGTCCCATCTACCCAGGGG + Intergenic
1001850917 5:174964322-174964344 GTGTGGTGTCATCTATCTAATGG + Intergenic
1004678092 6:17864033-17864055 ATGAGGTGCTATTTGTCTAGGGG + Intronic
1007373150 6:41439977-41439999 ATGTGGTGCCATTTCCCGAGGGG - Intergenic
1009835395 6:68994213-68994235 CTATAGTGCCTTTTATCTGGGGG - Intronic
1011444247 6:87420710-87420732 CTGTGATTTCATTTGTCTAGTGG + Intronic
1014281266 6:119444758-119444780 CTGTGGTGGCATTAATGGAGTGG - Intergenic
1015388683 6:132655500-132655522 CTGTGGTTCCATCTATTTAGGGG - Intergenic
1015713419 6:136166114-136166136 CTGTGCTGCCATGTGTCTAATGG + Intronic
1015943310 6:138474058-138474080 CTATGGTGCCATGGATCTCGGGG + Intronic
1016541156 6:145166549-145166571 CTGTTGAGCCATTTTTCTAAGGG - Intergenic
1018725431 6:166609134-166609156 CTGTGCAGACATTTATCCAGGGG - Intronic
1021541796 7:21767750-21767772 CTGTGGTGTCTTTTCTGTAGAGG + Intronic
1024245254 7:47464853-47464875 CATTGGTGCCATTTAAGTAGTGG - Intronic
1026330750 7:69350519-69350541 CTGTTGGACAATTTATCTAGTGG - Intergenic
1028867873 7:95734776-95734798 CTGAGGTGCCATTTTTGTGGTGG - Intergenic
1028941896 7:96530634-96530656 CAGTGATTCCATTTCTCTAGTGG + Intronic
1029505888 7:100963909-100963931 TTCTGGGGCCATTTATCTGGAGG + Intronic
1030192265 7:106821622-106821644 CTTTGCTGCAATTTATCTATGGG - Intergenic
1031057307 7:117006738-117006760 CTGTCGTGCCATTTTTCCAATGG + Intronic
1032714587 7:134495544-134495566 CTTAGGTGATATTTATCTAGTGG - Intergenic
1033573449 7:142656757-142656779 CTGTGGGGCCTTTTATCTCCTGG + Intergenic
1034081402 7:148280983-148281005 CTGTGGAGCCATTTATTCATGGG + Intronic
1036176044 8:6539424-6539446 CTCTGGTGCCAATTTCCTAGTGG + Intronic
1037537564 8:19839574-19839596 CTGTAGTTCCAGCTATCTAGAGG + Intronic
1038561533 8:28585315-28585337 CTGTGGTTCCAGTTATCAGGAGG - Intergenic
1038770193 8:30471479-30471501 TCATGGTGCCATTTATCTAGTGG - Intronic
1044984153 8:97743163-97743185 CTGCGGTGCCTTTCAACTAGTGG + Intergenic
1045322218 8:101090907-101090929 TGGGGGTGCCATTTACCTAGAGG + Intergenic
1047464821 8:125102534-125102556 GTGTGGTGGTATTTATCTGGGGG + Intronic
1050755783 9:9001508-9001530 CTGTGGTGCCATTTATCTAGAGG - Intronic
1057735265 9:97652502-97652524 CTGTGGTGCCAGCTACTTAGGGG + Intronic
1059142261 9:111864583-111864605 CTGTGGTGCCACTACTCAAGAGG + Intergenic
1061387952 9:130301513-130301535 CTGTGGTCCCATTTAGCTCATGG + Intronic
1061731056 9:132614377-132614399 CTGTGGGGCTCTGTATCTAGTGG - Intronic
1185851865 X:3496669-3496691 CTGTGCTGCCTTTTTTCTATTGG + Intergenic
1186102262 X:6169568-6169590 CTGTGATGCCCTTTAACTCGAGG - Intronic
1186214596 X:7285818-7285840 ATCTGTTGCCATTTATCCAGTGG + Intronic
1189078095 X:37939433-37939455 CTGTGGTAGAAATTATCTAGAGG + Intronic
1190681917 X:52833567-52833589 CTGTGGAGCCAGTTCTCTGGTGG + Intergenic
1194171108 X:90583636-90583658 GTGTTGTGGCATTGATCTAGTGG - Intergenic
1195228461 X:102822214-102822236 CTGTGTTGCCATTCACCTATGGG - Intergenic
1197239088 X:124104149-124104171 CTGAAGTGACATTTATTTAGTGG - Intronic
1199120236 X:144043938-144043960 ATGTGGTGATATTTATCTAATGG - Intergenic
1200517340 Y:4161380-4161402 GTGTTGTGGCATTGATCTAGTGG - Intergenic