ID: 1050756093

View in Genome Browser
Species Human (GRCh38)
Location 9:9005350-9005372
Sequence ATGTGTAAGTGGAAGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050756090_1050756093 10 Left 1050756090 9:9005317-9005339 CCTTGCCTGAATGTTGTGAAAAC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG No data
1050756089_1050756093 13 Left 1050756089 9:9005314-9005336 CCACCTTGCCTGAATGTTGTGAA 0: 1
1: 0
2: 1
3: 17
4: 171
Right 1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG No data
1050756091_1050756093 5 Left 1050756091 9:9005322-9005344 CCTGAATGTTGTGAAAACAAGAA 0: 1
1: 0
2: 1
3: 26
4: 360
Right 1050756093 9:9005350-9005372 ATGTGTAAGTGGAAGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050756093 Original CRISPR ATGTGTAAGTGGAAGTAGCA TGG Intronic
No off target data available for this crispr