ID: 1050756802

View in Genome Browser
Species Human (GRCh38)
Location 9:9014665-9014687
Sequence CATGGGAGACAATCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050756798_1050756802 26 Left 1050756798 9:9014616-9014638 CCAGCAATCAAGTTAACTTGACT 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050756802 Original CRISPR CATGGGAGACAATCTGAGGA AGG Intronic
No off target data available for this crispr