ID: 1050758790

View in Genome Browser
Species Human (GRCh38)
Location 9:9040454-9040476
Sequence CAAATTCTGCACATTTATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050758789_1050758790 9 Left 1050758789 9:9040422-9040444 CCTAGAGATTTTAAAGGTGTAGA 0: 1
1: 0
2: 2
3: 17
4: 238
Right 1050758790 9:9040454-9040476 CAAATTCTGCACATTTATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050758790 Original CRISPR CAAATTCTGCACATTTATAT TGG Intronic
No off target data available for this crispr