ID: 1050762965

View in Genome Browser
Species Human (GRCh38)
Location 9:9096221-9096243
Sequence TAGCCACCGTTGCCACAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050762964_1050762965 -7 Left 1050762964 9:9096205-9096227 CCAAATGAGTAGATTTTAGCCAC 0: 2
1: 1
2: 2
3: 23
4: 137
Right 1050762965 9:9096221-9096243 TAGCCACCGTTGCCACAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050762965 Original CRISPR TAGCCACCGTTGCCACAAAA TGG Intronic
No off target data available for this crispr