ID: 1050765664

View in Genome Browser
Species Human (GRCh38)
Location 9:9130357-9130379
Sequence GAATTCCAATGAAACTTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050765664 Original CRISPR GAATTCCAATGAAACTTAAC TGG (reversed) Intronic
907814499 1:57904863-57904885 GAATTCCATTGTAACTGAAATGG + Intronic
907836583 1:58114553-58114575 GTATTCCAATAAAACTTTACAGG - Intronic
908384071 1:63623876-63623898 AAGTTACAATGAAACTTAGCTGG - Intronic
908691782 1:66788511-66788533 AAATTCAAATGAGAATTAACAGG - Intergenic
909536444 1:76741645-76741667 GAATGCCAGTGAAACAAAACCGG - Intergenic
910085423 1:83396183-83396205 GAATGCCTATGGGACTTAACTGG + Intergenic
910825772 1:91405375-91405397 CAATTCTAAAGAAACTTAAAAGG - Intergenic
911550516 1:99273755-99273777 GAATTTCAATAAATTTTAACTGG + Intronic
912039435 1:105369004-105369026 GAATTCCAAAGAAAATTACTAGG + Intergenic
912884421 1:113454773-113454795 GAATTTCAATGAGAATTAAATGG + Intronic
913247465 1:116882751-116882773 GAACTCCATTGAAACTCTACCGG + Intergenic
913952029 1:143244224-143244246 GAATTCTCATGAAACTGAAATGG - Intergenic
917465560 1:175272847-175272869 GTATTACAAGGAAACTTAAAGGG - Intergenic
917615787 1:176742833-176742855 GAATTCCACTGATACTTACATGG + Intronic
918440063 1:184557933-184557955 GAATTCCTGTGGAACTTGACTGG + Intronic
918759547 1:188385564-188385586 GAAGGGCAATGAAACTTAAGCGG - Intergenic
921827364 1:219688235-219688257 GAATTCTCTTGAAACTTAATAGG + Intronic
923518785 1:234720276-234720298 AAATTCAAATGAAACTAAATGGG + Intergenic
923758733 1:236819602-236819624 GGATTCCCATGTAACTTAAAGGG + Intronic
923821906 1:237454082-237454104 GCTTTCCAATGAAAATCAACTGG + Intronic
923928842 1:238669343-238669365 GAATACCAAGGCAACTTAAAAGG - Intergenic
1064813268 10:19226563-19226585 GAATTCCCATGAAACCTTATAGG + Intronic
1065642635 10:27800977-27800999 TAATTTCAATGAAATTTAATTGG - Intergenic
1067315317 10:45155872-45155894 TACTTCCAATGAAACTAACCTGG - Intergenic
1068095423 10:52485623-52485645 AAATTCCCTTGAAACTTTACTGG - Intergenic
1068623769 10:59216368-59216390 GAGTTACAAAGAAACTGAACAGG - Intronic
1068930963 10:62589714-62589736 GTATTCCAATGATACTTACATGG - Intronic
1072082350 10:92044873-92044895 GACCTCCAATCAAACTTAGCTGG + Intergenic
1077801570 11:5544111-5544133 GAATTACAGTGAAACATAAAAGG + Intronic
1080119545 11:28661343-28661365 GAATTCCAGTGCAACGTACCTGG + Intergenic
1080328388 11:31106666-31106688 GAATTCCAATAAAATTTTAGAGG - Intronic
1083848983 11:65354638-65354660 AACGTCCAATGAAACTTAGCCGG + Intergenic
1083907125 11:65680190-65680212 GTTTTCCAAGGAAACTTAATGGG + Intergenic
1085905435 11:80755437-80755459 TAATTGGAATGAAACTGAACTGG + Intergenic
1086218808 11:84416472-84416494 GAATTAGAATGAAAGTTCACTGG + Intronic
1087252104 11:95914016-95914038 GAATTCTAATGGAAAATAACTGG + Intronic
1092400047 12:8167356-8167378 AAAATCCAATCAAACTGAACAGG + Intronic
1092589671 12:9940085-9940107 GAATTCCAACTGAAATTAACAGG + Intergenic
1095519482 12:43045605-43045627 GAATTTATAAGAAACTTAACAGG + Intergenic
1096102125 12:48976173-48976195 GAATATTAATGAAACTTACCTGG + Intergenic
1098425715 12:70364876-70364898 GACTTCAAATGTTACTTAACTGG - Intergenic
1102815753 12:115864780-115864802 TAAGTGCTATGAAACTTAACAGG + Intergenic
1105989005 13:25599662-25599684 GAATTCCAGGGAAACTTAGCTGG + Intronic
1106690354 13:32108675-32108697 GAAGTCCACTGAACCTTCACTGG + Intronic
1106837712 13:33653403-33653425 GAATGCCAATGCTATTTAACGGG + Intergenic
1116240048 14:42328895-42328917 ACATACCAATGAAATTTAACTGG - Intergenic
1117422342 14:55559120-55559142 GAATTCCAATTCATCTTTACTGG + Intronic
1119794570 14:77384357-77384379 GAATTCCAATTAAACATAGAAGG - Intronic
1129899644 15:79136661-79136683 GAATTCTGCTGAAATTTAACTGG + Intergenic
1131431530 15:92392898-92392920 TAATTCCAGTAAAACTTAATGGG + Intergenic
1133032140 16:3016302-3016324 GAATGCAAATGAAAGATAACAGG + Intronic
1135753179 16:25073418-25073440 GAACTCCGATGAGACTCAACAGG - Intergenic
1137002275 16:35239636-35239658 TAGTTCCAGTGAACCTTAACTGG - Intergenic
1137018581 16:35399761-35399783 TAATTCCAGTGAATTTTAACTGG - Intergenic
1137307294 16:47215247-47215269 GAACTCCAAAGAAACATTACTGG - Intronic
1138097317 16:54222140-54222162 GAAGTACAGTGAAATTTAACTGG - Intergenic
1140102538 16:71930603-71930625 GCATTCCAATAAAAGTTAACAGG + Exonic
1148783758 17:50135327-50135349 GAATTCCAATTCTACTTAACAGG - Exonic
1150262906 17:63811000-63811022 GAATGCCAAAGAAGCTTAATGGG + Intronic
1151104783 17:71600139-71600161 GAATTTCCATGAAAATTTACTGG + Intergenic
1153020504 18:624335-624357 CAATTACAATGTAACTCAACGGG + Intronic
1153573121 18:6493681-6493703 GCATTCTACTGAAACTTAACTGG + Intergenic
1157670636 18:49525467-49525489 GAACATCAGTGAAACTTAACAGG + Intergenic
1159261862 18:66024227-66024249 GAATCCAAATTAATCTTAACAGG + Intergenic
1160281695 18:77496876-77496898 GAATTCCAGTTAAATTTTACTGG + Intergenic
1163125354 19:15241438-15241460 GACTCCCAAAGAGACTTAACAGG - Intronic
1163352898 19:16790201-16790223 GAGTTCCCAAGAAACTCAACTGG - Intronic
1165646636 19:37444442-37444464 CAATGCAAATGAAAATTAACAGG - Intronic
928310828 2:30208182-30208204 GAATATCAATGAATATTAACTGG + Intergenic
928346045 2:30497022-30497044 GAAGTCTCATGAAACTTAGCAGG - Intronic
928953639 2:36838369-36838391 GAACTCCAGGGAAACTCAACTGG - Intergenic
929421663 2:41796703-41796725 TAATTTGAATGAAAATTAACTGG + Intergenic
929905320 2:46040562-46040584 GACTTCCAGGGACACTTAACAGG + Intronic
930179036 2:48333628-48333650 AAATTCTAATGAAATTTACCTGG + Intronic
930575065 2:53136573-53136595 GAATTCCTCTGAAACTAAAGTGG + Intergenic
930813854 2:55571457-55571479 TAATTCCAATCAAAATGAACTGG + Intronic
933006974 2:77006801-77006823 GATTTCCACTGAAGCTTAGCTGG - Intronic
934665784 2:96169313-96169335 GATTTCAAATGACACTTCACAGG + Intergenic
936434663 2:112493859-112493881 CATCTCTAATGAAACTTAACCGG - Intronic
937076614 2:119112045-119112067 GAATTTTAAAGAAAGTTAACAGG + Intergenic
938036869 2:128041902-128041924 GAATTCCTTGGAGACTTAACAGG + Intergenic
938149243 2:128867757-128867779 GATTTGCCATAAAACTTAACCGG - Intergenic
938268545 2:129948136-129948158 GAATTCCACTGAACCTCTACTGG + Intergenic
939902883 2:147871653-147871675 CAATTCCATTGAAACTGAAAAGG - Intronic
940690966 2:156920382-156920404 GAATTACAAGGAAACTTGAGAGG - Intergenic
940917233 2:159269503-159269525 GAATTCCAAGCAAACTAAATAGG + Intronic
943606397 2:189982444-189982466 GGATTGCAAAGAAACTCAACAGG - Intronic
944201659 2:197114020-197114042 GAAAACCAATGAAACTCAAAAGG + Intronic
948629937 2:239295700-239295722 GAAATAAAATGAAACTGAACGGG - Intronic
1169830936 20:9824210-9824232 TAATTCAAATGAAACACAACAGG - Intronic
1174390199 20:50214312-50214334 GAATCCCATTAAAACTTAGCAGG - Intergenic
1175196400 20:57246554-57246576 CAAATCCAATGATGCTTAACTGG + Intronic
1178115259 21:29410613-29410635 GAAGTCCAAGGAAACTCTACAGG + Intronic
1182171363 22:28233264-28233286 GAATTCTAATATAACTCAACTGG - Intronic
951099327 3:18668460-18668482 GAATTTAACTGAAACTTAACAGG - Intergenic
956984124 3:74677339-74677361 GAATTTCAATGTAAATTAATAGG + Intergenic
957498686 3:81024969-81024991 GAATTCCCATGAAACTTATTTGG - Intergenic
959594352 3:108113263-108113285 GAATTTCATTGAAAATTAAAAGG + Intergenic
961454913 3:127019229-127019251 GAATTCCACTGGGACTCAACTGG + Intronic
971425796 4:26514225-26514247 GGATTGCAATGAGACTAAACTGG - Intergenic
971734287 4:30426285-30426307 GAACCCCAAGGAAACTGAACTGG - Intergenic
975462363 4:74669251-74669273 GGATTCTAATGAAACTTTAATGG - Intergenic
976380911 4:84397463-84397485 AAATTCAAATCAAACTTAAGTGG - Intergenic
976381348 4:84402949-84402971 AAATTCAAATCAAACTTAAGTGG - Intergenic
976438193 4:85043441-85043463 CAGTTCCAATGAAACTAACCAGG - Intergenic
978934703 4:114360085-114360107 GAGTTCTAAAGAAACTTAAAAGG - Intergenic
979844799 4:125494455-125494477 GAAATCCAATAAAACTTGACAGG - Intergenic
980137569 4:128873599-128873621 GAATTCCAAAGAAAATTAACAGG - Exonic
981219694 4:142217083-142217105 GAATTCCAATGTAAATTAAAGGG - Intronic
982644395 4:158005144-158005166 CAATTCCATTAAAACTTAAGTGG - Intergenic
983386030 4:167062773-167062795 GACTTGCAATGAAAATGAACAGG - Intronic
983399539 4:167245464-167245486 GAATTCTATTTAAACTTAATTGG - Intergenic
983482758 4:168295325-168295347 GAATTGCAATGTAACTTAATAGG + Intronic
986432339 5:7693578-7693600 AAATTACAAAAAAACTTAACTGG - Intronic
987191293 5:15481023-15481045 GAATTCCATGGAATGTTAACAGG - Intergenic
988014366 5:25534312-25534334 GAATTCCATTGAAATTCTACTGG + Intergenic
988954776 5:36304352-36304374 GAACAGCAATGGAACTTAACAGG - Intergenic
989404880 5:41049352-41049374 GAATTCTGATGATACTAAACAGG + Exonic
996168047 5:120250692-120250714 AAATTCCAATAAAATATAACAGG + Intergenic
996465772 5:123800935-123800957 GAATCCCTATGATACTAAACAGG - Intergenic
997011397 5:129882883-129882905 GAATTCCAATCAAACATTTCTGG - Intergenic
997161460 5:131613746-131613768 GAACTCCACTGAAACTTATAAGG - Intronic
1001691377 5:173635060-173635082 GAATTCCAGTGTATCTAAACTGG + Intergenic
1001732617 5:173971663-173971685 GAATTTCAATGAGACTTCAGAGG - Intergenic
1002627395 5:180539887-180539909 GAATTCAAATGAAAATGAACAGG - Intronic
1004702661 6:18093442-18093464 GAATTCCAATGATAATTAAGAGG - Intergenic
1009519967 6:64669268-64669290 GAGTTGCAAAGAGACTTAACAGG + Intronic
1009594761 6:65720525-65720547 AAATTCCAGTGAAATTTCACAGG - Intergenic
1010465366 6:76161876-76161898 GAGAACTAATGAAACTTAACAGG + Intergenic
1010909230 6:81532915-81532937 GAAGTCCAATTCAATTTAACTGG + Intronic
1011643993 6:89440609-89440631 TAATTCCAATGAAAAGTATCAGG - Intronic
1020019999 7:4860049-4860071 GAATACCAATGAAAGTTCAGGGG - Exonic
1020897176 7:13954935-13954957 AAATGCCAATAAAACTTTACAGG + Intronic
1023230555 7:38023331-38023353 AAATTCCAAGGAAACTTCCCAGG - Intronic
1023330649 7:39112716-39112738 GAATAAAAATGAAACTTGACTGG + Intronic
1026167268 7:67921669-67921691 GAATTCAATTGGAACATAACAGG - Intergenic
1027302294 7:76852644-76852666 GAATGCCTATGGGACTTAACTGG + Intergenic
1030007879 7:105136327-105136349 GAAGTCCACTGAAACCCAACTGG + Intronic
1040746297 8:50646325-50646347 GAATTCAAAAGAAACTTTAGGGG - Intronic
1041605228 8:59774193-59774215 GAATTGCAACCAAACTTAATAGG - Intergenic
1042213846 8:66409033-66409055 AAATTCCAATGAATATTAAGGGG + Intergenic
1043217837 8:77618165-77618187 GAATGCCAATGAAAAGTAATAGG - Intergenic
1045648490 8:104321877-104321899 GGATCCCAATCAGACTTAACAGG - Intergenic
1047845339 8:128799715-128799737 TGCTTCCAAGGAAACTTAACAGG - Intergenic
1050535647 9:6628434-6628456 GAACTACAATGAAACTAACCAGG + Intronic
1050765664 9:9130357-9130379 GAATTCCAATGAAACTTAACTGG - Intronic
1050777934 9:9291079-9291101 AATTTCCTAAGAAACTTAACAGG + Intronic
1053539040 9:38954613-38954635 GCATTTCAAAGAACCTTAACTGG - Intergenic
1054627101 9:67409306-67409328 GCATTTCAAAGAACCTTAACTGG + Intergenic
1055381288 9:75709735-75709757 GAATTCCCAAGTAACTTATCTGG - Intergenic
1058217266 9:102250251-102250273 GAATTCCAATCAAGTTTTACAGG + Intergenic
1058305071 9:103430119-103430141 GATTTCCAAAGAAATTTAAGAGG - Intergenic
1185854537 X:3521771-3521793 GAATTCCAACAAAACTCAAGGGG + Intergenic
1185985612 X:4828993-4829015 GAATACAGATGAAACTTCACTGG + Intergenic
1188663009 X:32783471-32783493 GAAATACAATAAAAATTAACAGG + Intronic
1189683996 X:43544826-43544848 GATTTTCAATGAAACTTCAAAGG - Intergenic
1191030900 X:55969774-55969796 GAAATCCAAAGAAACATTACAGG + Intergenic
1191142080 X:57125412-57125434 GAATTTCAATGAAAAGTAAGGGG + Intergenic
1192579901 X:72272319-72272341 GAAAGCCAAGGGAACTTAACAGG + Exonic
1194325260 X:92507747-92507769 GAATTCAAAGGAAACTAAATAGG + Intronic
1194406763 X:93505849-93505871 GAACTCTAATGAAAATTAATAGG + Intergenic
1194541905 X:95183827-95183849 GAAATAAAATGAAAATTAACAGG + Intergenic
1194669424 X:96712171-96712193 GAAGTCAAATGAAACACAACTGG - Intronic
1197039187 X:121914934-121914956 AAATTCCTATGAAACTTACAGGG + Intergenic
1197173783 X:123463028-123463050 GAATTGAAATGAAATTTAATGGG + Intronic
1197257778 X:124282626-124282648 GAATTTCAGAGAAACTTAGCTGG - Intronic
1200808973 Y:7462751-7462773 GAATTCCAACAAAACTCAAGGGG - Intergenic