ID: 1050766096

View in Genome Browser
Species Human (GRCh38)
Location 9:9135710-9135732
Sequence TATATCCTATGTTAGAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050766092_1050766096 30 Left 1050766092 9:9135657-9135679 CCAATACTGAACTCACTTTATGC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 1050766096 9:9135710-9135732 TATATCCTATGTTAGAACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050766096 Original CRISPR TATATCCTATGTTAGAACTT TGG Intronic
No off target data available for this crispr