ID: 1050771751

View in Genome Browser
Species Human (GRCh38)
Location 9:9209952-9209974
Sequence TCCCATGGGGTGATGCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050771745_1050771751 -8 Left 1050771745 9:9209937-9209959 CCTCCTAAACTCAGATCCCATGG 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1050771751 9:9209952-9209974 TCCCATGGGGTGATGCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050771751 Original CRISPR TCCCATGGGGTGATGCAGAA GGG Intronic
No off target data available for this crispr