ID: 1050774798

View in Genome Browser
Species Human (GRCh38)
Location 9:9246486-9246508
Sequence CTGTGGGAGTGGAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1160
Summary {0: 1, 1: 1, 2: 8, 3: 129, 4: 1021}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050774798_1050774804 17 Left 1050774798 9:9246486-9246508 CCTTCCTGCCTCCACTCCCACAG 0: 1
1: 1
2: 8
3: 129
4: 1021
Right 1050774804 9:9246526-9246548 AATCTAGAAATCTTCTCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050774798 Original CRISPR CTGTGGGAGTGGAGGCAGGA AGG (reversed) Intronic
900037533 1:429901-429923 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
900059161 1:665642-665664 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
900361033 1:2289245-2289267 CTGACAGAGAGGAGGCAGGAGGG - Intronic
900370746 1:2331128-2331150 TTGTGGGAGGGGAGACAGGGTGG - Intronic
900407782 1:2500022-2500044 CTGTAGGGGTGGAGGCTGCAAGG - Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
901054247 1:6441227-6441249 CTGAGGGAGTAGAGGCACAAAGG + Intronic
901421314 1:9153095-9153117 ATGTGGGTGTGGGGGCATGAAGG + Intergenic
901447738 1:9318475-9318497 ACCTGGGAGTGGAGGAAGGAGGG - Intronic
901802915 1:11719561-11719583 CTGGGCGAGTGGAGGCAAGGGGG - Intronic
901849474 1:12006572-12006594 CTGTGGCAGTGGGGGCATGCTGG - Exonic
902131333 1:14263628-14263650 GTGTGGGAGCGGGGGCAGGGTGG + Intergenic
902480065 1:16707104-16707126 CTGAGGGAGTAGAGGCACAAAGG - Intergenic
902774252 1:18664445-18664467 CTGGGGAAGGGGAGGGAGGAGGG + Intronic
903012282 1:20339677-20339699 ATGTGTAAGTGGAGGCAGGGAGG - Intronic
903066312 1:20701639-20701661 AGGTGGGTGGGGAGGCAGGAAGG + Intronic
903190064 1:21651367-21651389 ATGTGGGAGTAGGGGCAGGCAGG - Intronic
903337760 1:22636450-22636472 GTGTGGGAGTGGGGGCAGTGAGG - Intergenic
903450913 1:23453029-23453051 CTGTGTGAAAGGGGGCAGGAGGG + Intronic
903593072 1:24471878-24471900 AGCTGGGAGTGGAGGCAGGAGGG + Intronic
904000150 1:27334290-27334312 GTGTGGGTGGGCAGGCAGGAGGG - Intronic
904016866 1:27428491-27428513 CTGTGGGAAGGGTGGCAGGAAGG - Intronic
904179459 1:28655680-28655702 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
904330711 1:29756186-29756208 CAGAGGGAGGGGAGGCCGGAGGG + Intergenic
904335960 1:29798277-29798299 CTGGGGAAGAGGAGGCAGGGTGG - Intergenic
904347746 1:29884364-29884386 CGATGGGAGTGGGGGCAGAAGGG - Intergenic
904499391 1:30905413-30905435 CTGTGGTTGGGAAGGCAGGAGGG - Intronic
904594520 1:31635127-31635149 CTGTGGGTGTGCAGGCAGCCTGG - Intronic
904681645 1:32233531-32233553 CTTTGGGAGCTGAGGCAGGCAGG - Intergenic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904810320 1:33159605-33159627 CAGTGGGAGTGGAGGCAGATGGG - Intronic
904830929 1:33306526-33306548 CCGTGGGAGTGGGAGTAGGAGGG - Intergenic
904954136 1:34268805-34268827 CTGAGGCACTGGAGGCAGGCAGG + Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905118957 1:35666992-35667014 CTTTGGGAGTGGAGGAAGAAGGG + Intergenic
905354098 1:37369071-37369093 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905387591 1:37614977-37614999 CTGGGGGAATGGGGGCAGGGTGG + Intronic
905465257 1:38148390-38148412 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
905519898 1:38589606-38589628 CTGGGGGAGTGGAGGGTGTAGGG - Intergenic
905536739 1:38728410-38728432 GGGTGGGAGTGGGGGCTGGAGGG - Intergenic
906050519 1:42867705-42867727 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
906145688 1:43558757-43558779 CTGGGGGAGGGGAGGGAGGCAGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
906659644 1:47573321-47573343 CTGAGGGAGGGAGGGCAGGAGGG - Intergenic
906680216 1:47721200-47721222 CTGTGGGAGAGGAAGCAGAATGG - Intergenic
906700888 1:47857280-47857302 CTCTGGGAGTGGCTTCAGGAAGG - Intronic
906789308 1:48644681-48644703 AGATGGGAGTGGATGCAGGAAGG + Intronic
906831856 1:49041160-49041182 CTCAGGGAGAGCAGGCAGGAAGG - Intronic
907081245 1:51624343-51624365 CTTTGGGAGTCGAGGCAGGTGGG + Intronic
907165521 1:52407257-52407279 CTTTGGGAGGCGAGGCAGGTGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907271715 1:53295232-53295254 CTGTGGGAGTGAAGAGAGCAGGG + Intronic
907613183 1:55893698-55893720 TTGGGGGAGTGGGGGCTGGAGGG - Intergenic
907780373 1:57561125-57561147 CTGGGGGAGAGGAGGCAGGGTGG - Intronic
907905248 1:58778561-58778583 CTGCATTAGTGGAGGCAGGAAGG + Intergenic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
908029328 1:59983124-59983146 CAGTGGCAGATGAGGCAGGAGGG + Intergenic
908074178 1:60495983-60496005 CTGTGGGGGTGGGGGGAGGGTGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908515147 1:64884640-64884662 CAGTGTGAGTGAAGGCAGGAGGG - Intronic
909172577 1:72315175-72315197 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
909548915 1:76876892-76876914 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
909736419 1:78968232-78968254 CTGTGGGAGTTCAGTCAGGCTGG + Intronic
909897822 1:81095395-81095417 CTCAGAGAATGGAGGCAGGATGG + Intergenic
910630254 1:89346543-89346565 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
910638955 1:89439683-89439705 CTGGGGGAGAGCAGGCAGGATGG + Intergenic
910831061 1:91463133-91463155 CTGGGGGAGAGCAGGCAGGGTGG + Intergenic
910831679 1:91467732-91467754 CTGTGGGAGTTCAGTCAGGGTGG + Intergenic
911175427 1:94812826-94812848 CTGTGGGAGTACAGTCAGGGTGG + Intergenic
911276130 1:95861607-95861629 GTGTGGAGGTGGAGGCAGGTGGG + Intergenic
911738364 1:101361628-101361650 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
911780570 1:101870734-101870756 CTGTGGGGGTGTAGGCAGAAAGG + Intronic
911981869 1:104578973-104578995 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
912755540 1:112321769-112321791 CAGAGGGAGTGGAGAGAGGATGG - Intergenic
912823537 1:112885908-112885930 GTGTGGGGGTGGGGGCAGGGAGG - Intergenic
913124451 1:115772259-115772281 CTGGTGCAGAGGAGGCAGGAAGG - Intergenic
913266640 1:117051623-117051645 CTGTGAGAGTGAAAGCAGGAAGG + Intergenic
913530262 1:119729066-119729088 GATGGGGAGTGGAGGCAGGAGGG - Intronic
914264100 1:146022802-146022824 CTTTGGGAGCTGAGGCAGGAGGG + Intergenic
914360109 1:146927702-146927724 CTGTGGGAGGAGAGACAGGCTGG + Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914743532 1:150484693-150484715 GTGTTGCAGTGGAGGAAGGAAGG - Intergenic
914965476 1:152253615-152253637 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
915244208 1:154544697-154544719 ATGTGAAAGTGGAGGTAGGAGGG - Intronic
915268627 1:154735882-154735904 CTGTGGGAGGGGACACAGAAGGG + Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915574701 1:156767917-156767939 CTGAGGGGGCGGAGGCAGCAAGG - Exonic
915583658 1:156831401-156831423 CTGGGGCAGTGGTGACAGGAGGG + Intronic
915599724 1:156914575-156914597 CAGTGGGAGTGGAGGGAGTGGGG + Intronic
915709693 1:157883934-157883956 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
915952033 1:160195874-160195896 CTTTGGGAGAGGGGGTAGGAGGG - Intronic
915981105 1:160420388-160420410 CTGTGGGGGAGACGGCAGGAGGG - Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916897640 1:169182110-169182132 CTCTGGAAGCTGAGGCAGGAAGG - Intronic
917243513 1:172974904-172974926 ATGTGGGCCTGTAGGCAGGAGGG - Intergenic
917515327 1:175702424-175702446 CTGTGGGTCTGGAAGCTGGAAGG - Intronic
917764558 1:178202300-178202322 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
918216530 1:182396657-182396679 AGGTGGGAGGGGAGGGAGGAAGG - Intergenic
918221675 1:182441230-182441252 TTGTGGGAGGAGAGGCAAGAGGG + Intergenic
918259549 1:182783209-182783231 CTGAGGGGGCTGAGGCAGGAGGG - Intergenic
918740891 1:188128871-188128893 CTGTGGGAGAGCAGGCGGCAAGG - Intergenic
918755682 1:188337518-188337540 CTATGGGAGAGAAGGCAGGGTGG + Intergenic
919071502 1:192761656-192761678 GGATGGGAGAGGAGGCAGGAAGG + Intergenic
919478372 1:198056283-198056305 CTATGGCAGTGGTGGCAGGGTGG + Intergenic
919897115 1:202015857-202015879 CTGTGGGAGAGGAGTGGGGAGGG - Exonic
919988158 1:202690108-202690130 CAGGGGGAGTGGAGGCAGAGTGG - Intronic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920227191 1:204447342-204447364 CTTTGGGAGTGGAGGTGGGAAGG - Intronic
920502024 1:206491488-206491510 CTCTGGGAAAGGAGGAAGGACGG - Exonic
920542366 1:206788768-206788790 CTAAGGCAGTGCAGGCAGGATGG + Intergenic
920654823 1:207867636-207867658 CTTTGGCATTGGTGGCAGGAGGG - Intergenic
920802105 1:209199172-209199194 CTGTGGGGGAGATGGCAGGAAGG - Intergenic
921026930 1:211293169-211293191 CTGTAGGAATGAAGGAAGGATGG - Intronic
921068844 1:211642561-211642583 CAGAGGTAGTGAAGGCAGGAGGG - Intergenic
921841152 1:219830021-219830043 CTGGGAGAATGGAGGCGGGAAGG - Intronic
922433606 1:225581431-225581453 GAGTGGGAGTGGAGGGTGGAGGG + Intronic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
923049674 1:230381893-230381915 CTGTGAGAGTGGATGTAGGATGG - Intronic
923080723 1:230651924-230651946 CTGTGAAGGGGGAGGCAGGAGGG - Intronic
923138010 1:231135256-231135278 CTTTGGGAGCCAAGGCAGGAGGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923476359 1:234335337-234335359 GGGTGGGAGTGCAGGCAGGATGG - Intergenic
924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG + Intronic
924458075 1:244234106-244234128 CAGAGGGGGTGGCGGCAGGAAGG - Intergenic
924661008 1:246016701-246016723 CTGTGGAAGAGGGGCCAGGAGGG + Intronic
924775566 1:247112734-247112756 CTGTAGGTGGGGAGGCAGGCAGG + Intergenic
924847102 1:247784846-247784868 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063813454 10:9742055-9742077 TGGTGGAAGGGGAGGCAGGAAGG - Intergenic
1064435802 10:15310467-15310489 CTGTGGGAGAGGGGCCAGGTTGG - Intronic
1065838681 10:29682002-29682024 CTGAGGGAGTGGGGACAGGAAGG - Intronic
1065925319 10:30429951-30429973 CTTTGGGAGGCGAGGCAGGTGGG - Intergenic
1066046290 10:31598356-31598378 ATGTGGGAGAGAAGCCAGGATGG + Intergenic
1066153381 10:32649152-32649174 CTGTGGGAGTTGTGGTGGGAGGG + Intronic
1066203835 10:33167448-33167470 CTTTGGGAGGTGAGGCAGGCAGG - Intergenic
1066228829 10:33411987-33412009 CTGTGAGGGTGAAGGCAGGAAGG + Intergenic
1066329444 10:34403813-34403835 CAATGGGAGTGGGTGCAGGAAGG + Intronic
1066716293 10:38289834-38289856 GTGTGGGAGGGGAGGATGGAAGG - Intergenic
1066957652 10:42188344-42188366 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1067712949 10:48664878-48664900 CTGTGGGACAGGAAGCAGGCAGG - Intergenic
1068447237 10:57138885-57138907 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1068837182 10:61568090-61568112 CTGGGGGAGAGGAGCCAGGGTGG + Intergenic
1068956573 10:62823895-62823917 AGGTGGGAGAGGAGTCAGGAAGG - Intronic
1069266045 10:66459026-66459048 AAGTGGAAGGGGAGGCAGGAGGG - Intronic
1069580547 10:69563123-69563145 CTTCGGGAGTGGGGGCAGGGAGG + Intergenic
1069790798 10:71019293-71019315 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1069843119 10:71352358-71352380 CTGTGAGAAGGTAGGCAGGAGGG + Intronic
1069957312 10:72060012-72060034 CCAGGGGAGTGGGGGCAGGAAGG + Exonic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1070585430 10:77762457-77762479 CTGGGGAAGGGGAGGAAGGAGGG - Intergenic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070734725 10:78855616-78855638 CAGTGGGAGATGAGGCAGGCAGG + Intergenic
1070847964 10:79539287-79539309 CTGTGGTTGGGGAGGAAGGAGGG + Intergenic
1071306401 10:84302826-84302848 CTGGGGGAGAGGAGGCAGCATGG - Intergenic
1071937720 10:90549566-90549588 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1072456848 10:95583924-95583946 CTGTGGGACTGGTGAAAGGATGG + Intergenic
1072737507 10:97889106-97889128 CAGGGGCAGTGGAGGCGGGAGGG + Intronic
1072802781 10:98404992-98405014 GTGAGGGAGGGGAGGGAGGATGG + Intronic
1073214727 10:101829864-101829886 CTGTGGGGGCGGAGGGAGGCTGG + Exonic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073456183 10:103638098-103638120 CTGTGTGGGTGCACGCAGGAGGG - Intronic
1073531013 10:104232100-104232122 CGGAGGGAGAGGAGGGAGGAGGG + Intronic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1074146389 10:110720755-110720777 CTGTGGGAGAGCAGGCTGTAGGG - Intronic
1074349177 10:112717966-112717988 CTGTGGGAAGGGAGCAAGGAAGG - Intronic
1074858328 10:117490013-117490035 CTCTTGGAGGGGAGGCAGGAAGG + Intergenic
1074911736 10:117916301-117916323 CTTGGGGAGGGGAGACAGGAGGG + Intergenic
1075081210 10:119385105-119385127 CAGTTGGAGGGGAGGGAGGAGGG + Intronic
1075427874 10:122355974-122355996 CTGGGGTTGTGCAGGCAGGATGG + Intergenic
1075606818 10:123817689-123817711 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1075721599 10:124590727-124590749 CGGTGGCAGAGGAGGCAGGCAGG - Intronic
1076210232 10:128634834-128634856 CAGGGAGAGTGGAGGCAGGGAGG - Intergenic
1076342680 10:129760249-129760271 CTGTGTGTGTGGGGGCAGAAAGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076558744 10:131347184-131347206 GAGAGGGAGGGGAGGCAGGAAGG - Intergenic
1076822407 10:132945972-132945994 CTGTGAGAGTGTCAGCAGGAGGG + Intergenic
1076887293 10:133268562-133268584 CTGGCCGAGTGGAGCCAGGAAGG + Intronic
1076964259 11:67824-67846 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1077013911 11:391723-391745 CGGTGGGAGAGGGCGCAGGAGGG - Intergenic
1077252876 11:1568322-1568344 CAGAGGGAGGGGAGGGAGGAGGG + Intronic
1077320536 11:1938971-1938993 CTATGGGAGTGGAGAGTGGAGGG - Intergenic
1077339917 11:2021679-2021701 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1077343229 11:2035285-2035307 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1077420873 11:2449291-2449313 CTGGGGTACTGGGGGCAGGAGGG + Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1077486258 11:2839640-2839662 CTGGGGGAGGGAAGGCAGCAGGG + Intronic
1077525567 11:3062460-3062482 AACTGGGAGTGCAGGCAGGAAGG + Intergenic
1077673511 11:4178918-4178940 CTGTGGTGGTAGAGGCAGGTTGG + Intergenic
1077920688 11:6639924-6639946 CTGTGGCAGAGGAGGCTAGAGGG + Exonic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1078600633 11:12727294-12727316 CTGTGGGTGGGGATGCTGGATGG + Intronic
1078919892 11:15819980-15820002 CTGTGGGTGTGGAGTCAAGCAGG - Intergenic
1078986359 11:16603519-16603541 CTTTGGGAGTGGGGGTGGGAGGG + Intronic
1080299149 11:30764983-30765005 TTGTGGGGGAGGAGACAGGATGG + Intergenic
1081296552 11:41397249-41397271 AGGTGGAAGAGGAGGCAGGAGGG - Intronic
1081378319 11:42386208-42386230 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1081509039 11:43749508-43749530 CAGTGTGAGAGGAAGCAGGAGGG + Intronic
1081578590 11:44335233-44335255 TTGTGTGAGTGAAAGCAGGAGGG - Intergenic
1081674414 11:44960249-44960271 CTGTGAGAGTGGAGGTGGTAAGG + Intergenic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082003666 11:47408458-47408480 CGGGGGGAGTGGCGGCGGGAGGG - Intronic
1082684275 11:56219462-56219484 GTGTGGGGGTGGAGCCAAGATGG + Intergenic
1082806633 11:57455815-57455837 CTGGGAAAGTGGAGGCAGCATGG + Intergenic
1082856071 11:57807896-57807918 CTATGGGAGAGGAGGCAAGAAGG + Intronic
1082956691 11:58877404-58877426 CAGAGGGAGTGGAGCCAAGATGG - Intronic
1083887890 11:65581607-65581629 CTGGGGGACTGGGGGCCGGAGGG - Exonic
1084117472 11:67050474-67050496 CCAGGGGACTGGAGGCAGGATGG + Exonic
1084147057 11:67270553-67270575 CTGCAGGAGTGAAGGAAGGAGGG - Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084215032 11:67642489-67642511 CTGGGGAAGTGGATGGAGGAAGG - Intergenic
1084790281 11:71471201-71471223 CCGTGGAAGAGGTGGCAGGAAGG + Intronic
1085046249 11:73355510-73355532 CTGTGGAGGAGGAGGCAGGTTGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085409374 11:76282278-76282300 CGATGGGAGTGGAGGCTGGATGG + Intergenic
1085685987 11:78622455-78622477 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1085712360 11:78841658-78841680 CTGTGGGAAAGGAGCCAGGGGGG - Intronic
1086278638 11:85160717-85160739 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1087134829 11:94706134-94706156 CTGGGGAAGTGGAAGCAGGGAGG - Intergenic
1087215391 11:95487895-95487917 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1087374049 11:97320816-97320838 CTGGGGGAGAGAAGGCAGGGCGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1088269582 11:108020026-108020048 CAGTGGGGGTGGGGGCAGGGTGG - Intronic
1088391459 11:109319478-109319500 CTGAGGCACTGCAGGCAGGAAGG - Intergenic
1088622241 11:111697746-111697768 CTTTGGGTGCTGAGGCAGGAGGG + Intronic
1088626389 11:111733326-111733348 CTGGGAGGGTGGAGACAGGAGGG + Intronic
1088815810 11:113420006-113420028 TTTTGCGGGTGGAGGCAGGAGGG + Intronic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089493423 11:118897132-118897154 CTCAGGGAGTGGAGACTGGAGGG + Exonic
1089540014 11:119184128-119184150 CAGAGGCAGTGGAGGCTGGAAGG + Intergenic
1089613289 11:119681458-119681480 CTGAAGGTGTGGAGGCAGGCAGG + Intronic
1089903639 11:122013877-122013899 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1090119168 11:124006108-124006130 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090299892 11:125626188-125626210 TTGTGGGGGCGGGGGCAGGAGGG + Intronic
1090405795 11:126475247-126475269 CTGAGCCAGTGGAGTCAGGACGG - Intronic
1090640361 11:128724608-128724630 CTCAGGCAGTGTAGGCAGGAGGG - Intronic
1090815492 11:130290494-130290516 CAGTGGCAGTGGAGAAAGGAAGG - Intronic
1091252341 11:134154423-134154445 CTGAGGAAGAGGACGCAGGAGGG - Intronic
1091285669 11:134407385-134407407 ATGGGGGAGTGGAGACATGACGG - Intronic
1202822902 11_KI270721v1_random:76868-76890 GTGTGGGGGTGGCGGCAGGAAGG - Intergenic
1202826215 11_KI270721v1_random:90474-90496 CTGAGGGAATGCAGGCGGGATGG - Intergenic
1091691817 12:2602243-2602265 CCGTGGTGGAGGAGGCAGGAAGG - Intronic
1091969487 12:4773573-4773595 TGGTGGGAGAGGAGGTAGGATGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092890972 12:12969024-12969046 CAGTGTGAGTGAAGGCATGAAGG + Intergenic
1093036369 12:14335949-14335971 CTGTGGGAGAGAAGGCAGGGTGG - Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093385765 12:18551428-18551450 ATGTGGGAGGGGAGGTAGGCAGG - Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094729778 12:33161573-33161595 CTGTGGGAGAGGGAGCATGAGGG + Intergenic
1095177513 12:39110310-39110332 ATGTTGGGGAGGAGGCAGGAGGG - Intergenic
1095217809 12:39569756-39569778 CTGGGGGAGTGGAGCCAAGAGGG - Intronic
1095466259 12:42490685-42490707 CAGTGGAAGGGGTGGCAGGAGGG + Intronic
1095498600 12:42811938-42811960 CTGTGGGAGTGGAGAAGGGAGGG + Intergenic
1095603887 12:44044590-44044612 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
1095839265 12:46674331-46674353 GTGTGGCAGTGGTGCCAGGAGGG + Intergenic
1095856215 12:46863410-46863432 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1095882914 12:47157480-47157502 CTGGGGAGGTTGAGGCAGGAAGG + Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096408720 12:51362173-51362195 CTGTGGGGGAGGAAGCAGGTTGG - Intronic
1096604922 12:52757835-52757857 AGGTGGGTGTGGAGGCAGGCAGG - Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097040109 12:56151322-56151344 CTTTGGGAGGCGAGGCAGGTGGG - Intergenic
1097190981 12:57219590-57219612 AGGAGGGTGTGGAGGCAGGAGGG - Intronic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097528820 12:60772893-60772915 CTGTGGGGGTTGAGGAGGGAAGG + Intergenic
1097616105 12:61886368-61886390 CAGTGGCAGTGGGGGCAGGGGGG - Intronic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1098749875 12:74279855-74279877 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1098831874 12:75373763-75373785 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1099365959 12:81765650-81765672 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1099375681 12:81894223-81894245 CCGTGGGAGAGAAGGCAGGGTGG - Intergenic
1099717152 12:86310559-86310581 CTGTAGGAATGGAGTCAGTAAGG - Intronic
1100241120 12:92711342-92711364 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101348527 12:103907058-103907080 CTGTTGGAAGGGAGGAAGGAAGG + Intergenic
1101543101 12:105682901-105682923 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1101662043 12:106774605-106774627 CTGGCGGGTTGGAGGCAGGACGG + Intronic
1101679656 12:106953294-106953316 CTTGGGAAGTTGAGGCAGGAAGG - Intergenic
1102038637 12:109786681-109786703 CTGGGGCAGTGGGGCCAGGATGG - Intronic
1102636730 12:114331179-114331201 TTGAGGGAATGGAGGCAGGGAGG + Intergenic
1102637329 12:114335757-114335779 CTGGGGGAGGGGAGGAAGTAGGG + Intergenic
1102961422 12:117095961-117095983 CTGTGGGACTGCAGGCAAGCTGG + Intronic
1103035644 12:117654340-117654362 CTGGGGAAGAGAAGGCAGGATGG - Intronic
1103348921 12:120269606-120269628 CTTTGGGAGGTGAGGCAGGTGGG - Intergenic
1103437466 12:120937820-120937842 GTGAGGGAGAGGAAGCAGGATGG - Intergenic
1103717756 12:122955532-122955554 ACCTGGGAGGGGAGGCAGGAGGG + Intronic
1103939790 12:124495493-124495515 GTGTGGCAGTGGATGGAGGAGGG - Intronic
1104919860 12:132285149-132285171 CTGAGGGAGGGCAGGCAGGAGGG - Intronic
1104921230 12:132291799-132291821 CTGAGGGTGTGGGGACAGGAGGG - Intronic
1105847215 13:24303541-24303563 CTGAAGGCGTGCAGGCAGGAGGG - Exonic
1107686327 13:42903406-42903428 CTGTTGGAGTGGAGGATGCAGGG + Intronic
1108302404 13:49091731-49091753 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1108352925 13:49603507-49603529 CTGTGAGACTGGAAGCAAGATGG + Intergenic
1108441898 13:50462708-50462730 CTCAGGGAGTGGGGGCAGGAAGG + Intronic
1108479442 13:50853638-50853660 CTCTGGGAGTGGAGGAGGGCTGG - Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1110661641 13:78064597-78064619 CTGTAGGAGTGGGGGAGGGAGGG - Intergenic
1111198566 13:84905149-84905171 CTGGGGGAGAGAAGGCAGCATGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111701013 13:91689058-91689080 CTTGGGAAGTTGAGGCAGGAGGG + Intronic
1113073145 13:106441149-106441171 GTGTGGGGGTGGAGGCTGGAAGG + Intergenic
1113319677 13:109221397-109221419 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1113396168 13:109949798-109949820 CTGGGGGAGAGAAGGCAGGGAGG - Intergenic
1113576142 13:111396508-111396530 CTGTGGGGGCGGAGGCGGGGTGG + Intergenic
1113595679 13:111530227-111530249 GGGTGGGAGTGGAGGCAGAAAGG + Intergenic
1113610681 13:111642777-111642799 CTGTAAAAGTGGAGGCAGAAAGG - Intronic
1114029259 14:18561551-18561573 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1114205898 14:20571034-20571056 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114479426 14:23023158-23023180 ATGTGGGGGAGGAGGGAGGAAGG - Intronic
1114560783 14:23589042-23589064 CTGTGGGGGTGGAGGTGGGAGGG + Intergenic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115529923 14:34317588-34317610 CTGAGGAACTGAAGGCAGGAAGG + Intronic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1116962805 14:50983993-50984015 CTGAGGGAGGGGAGGAGGGATGG + Intronic
1117283672 14:54265316-54265338 ATGCAGGAGTGCAGGCAGGATGG - Intergenic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1117866923 14:60159755-60159777 CTGGGGGAGGGGAGATAGGAAGG - Intronic
1118328243 14:64795952-64795974 CTGTTGGATTTGGGGCAGGAAGG + Intronic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118810330 14:69268510-69268532 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
1118880742 14:69823755-69823777 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118950728 14:70434319-70434341 CTGCGGGAGAGGAGGCAGGGTGG + Intergenic
1119170278 14:72529651-72529673 CTGTGGGATTGCAGGGAGGGGGG - Intronic
1119419797 14:74501694-74501716 CTGTGGGGGTGGGGGCAGAGAGG + Intronic
1119757333 14:77128381-77128403 GGGTGGGAGTGGAGGTAGGAGGG - Intronic
1120336779 14:83167612-83167634 CAGTGGGAGTGGAGTAAGGTGGG - Intergenic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1120973732 14:90231098-90231120 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1121055368 14:90847372-90847394 CTCAGGGAGTGGGGGCAGGAGGG + Intergenic
1121322381 14:92999522-92999544 CAGTGGGTGGGGAGGCTGGAAGG + Intronic
1121991028 14:98557382-98557404 CTGTGGGAGTAGACACAGGCTGG + Intergenic
1122257583 14:100490286-100490308 GGGAGGGAGGGGAGGCAGGAAGG + Intronic
1122376116 14:101259487-101259509 CTATGGGAGTGAAGTCAGAACGG - Intergenic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122597613 14:102904034-102904056 CTGTGGGTGCTGAGGCCGGAGGG + Intronic
1122695743 14:103551229-103551251 CTGTGGGGGTGGAGGCGGCCTGG + Intergenic
1122859825 14:104577553-104577575 ACGTGGGAGTGGAGGCTGCAGGG - Intronic
1122974693 14:105166275-105166297 CAGTGGGTGTGGGGGCAGGGAGG - Intronic
1123113057 14:105882019-105882041 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123114822 14:105889933-105889955 GTGTGTAAGTGGTGGCAGGAAGG + Intergenic
1123115406 14:105892169-105892191 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123119657 14:105910887-105910909 CTCTGGGAGGAGAAGCAGGATGG - Intergenic
1123148947 14:106163145-106163167 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1123677822 15:22729222-22729244 CTGAGGAAGAGGAGGAAGGAGGG + Intergenic
1123696846 15:22884750-22884772 CTGTGGGGGTGGAGCCATCATGG - Intronic
1124373628 15:29117008-29117030 TTGTGGGAGGGGAGGTGGGAGGG + Intronic
1124383948 15:29190582-29190604 GTATGGGAGGGGAGGAAGGAGGG + Intronic
1124719723 15:32100804-32100826 CTGTGTGAGTGGTGCCATGAGGG - Intronic
1125423480 15:39527421-39527443 AAGTGGAAGGGGAGGCAGGAGGG - Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125726059 15:41868681-41868703 CTGTGTGAGTGGACTCAGGTGGG - Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126125524 15:45292137-45292159 CTTGGCCAGTGGAGGCAGGATGG - Intergenic
1126187166 15:45841630-45841652 TTGTGGGAGTGGGAGCAGGCAGG - Intergenic
1126283641 15:46986543-46986565 CTGGGGAAGAGAAGGCAGGATGG - Intergenic
1126675681 15:51157779-51157801 CTGGGGGAGGGGTGGCAGGGTGG + Intergenic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127868253 15:63048773-63048795 CTGCGGGGGGGGAAGCAGGAGGG - Intronic
1128448451 15:67785635-67785657 CTGGAGGTGTGGAGGCAGCAGGG + Intronic
1128719898 15:69940567-69940589 CTGTGGTGGTGGGGGCATGAGGG - Intergenic
1128765095 15:70246511-70246533 CTGTGGGTGTTGGAGCAGGACGG + Intergenic
1128807244 15:70540167-70540189 CAGTGGGAGGGGGTGCAGGATGG - Intergenic
1129117917 15:73375554-73375576 TTGTAGAAGTGGAGGCAGGGAGG + Intergenic
1129200156 15:73993876-73993898 CTGAGGTGGTGGGGGCAGGAGGG - Intronic
1129311017 15:74708994-74709016 GTGTGGTAGTGGAGGCAGACGGG - Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129658835 15:77541957-77541979 CTGGGGGAGGGCAGGAAGGATGG - Intergenic
1129909539 15:79214707-79214729 CAGTGGGAGTGGTGGGAGGCTGG + Intergenic
1130065811 15:80604221-80604243 CTCTGGGAGTGGAGGCTGAGAGG - Intergenic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130348459 15:83069249-83069271 CTCTGGGCGTGGGGGCAGGAGGG + Intergenic
1130392111 15:83466030-83466052 AGGAGGGAATGGAGGCAGGAAGG - Intronic
1131072800 15:89476687-89476709 CTGATGCAGTGGAGGCAGGGAGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131452887 15:92560888-92560910 CTGTGGACCTGGAGGCAGGCAGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132444291 15:101897359-101897381 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1132734177 16:1377494-1377516 CAGGGGGAGTGGAGGCAGAGGGG - Intronic
1132758420 16:1497129-1497151 CTGTGAGGGTCGGGGCAGGATGG - Intronic
1132772932 16:1574685-1574707 AGGTGGGAAGGGAGGCAGGAGGG - Intronic
1132877272 16:2145623-2145645 CTGTAGGCCTGGAGGCAGGGAGG - Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132892358 16:2210552-2210574 CTGTGGGGGTTGTGGCTGGAGGG - Exonic
1134307888 16:13049764-13049786 AAGTGGAGGTGGAGGCAGGAGGG - Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1136143634 16:28302557-28302579 CTCTGGGGGTGCAGGCAGGTGGG + Intronic
1136681277 16:31964437-31964459 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136687279 16:32002856-32002878 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1136781589 16:32905949-32905971 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1136881890 16:33907382-33907404 CTGGGAGTGGGGAGGCAGGAGGG - Intergenic
1136888204 16:33947891-33947913 GTGTGAGAGAGGAGGGAGGAAGG + Intergenic
1136998694 16:35208897-35208919 ATGTGGACGTGGAGGCATGAGGG + Intergenic
1137571759 16:49570928-49570950 CTGGGGTAGAGCAGGCAGGAGGG + Intronic
1137673214 16:50291341-50291363 CTCTGGGGGTGGAGGGAGGGCGG + Intronic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138511046 16:57508551-57508573 GTGTTAGAGGGGAGGCAGGAGGG - Intergenic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1138868407 16:60851048-60851070 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1139086971 16:63598807-63598829 GTATGGGAGTGAAGGCAGTAGGG + Intergenic
1139291972 16:65867591-65867613 GTGTGGGGGTGGGGGCTGGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1139759318 16:69171670-69171692 CTGTGGGAGAGGGGAGAGGAGGG + Intronic
1140874412 16:79137717-79137739 CAGGAGGAGTGGGGGCAGGAAGG - Intronic
1141147223 16:81539720-81539742 ATGAGTGAGTGAAGGCAGGAGGG - Intronic
1141508605 16:84497511-84497533 CTCTGGGAGGGCAGTCAGGAGGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1141845286 16:86604237-86604259 TGGTGGGAGTGGGAGCAGGAGGG - Intergenic
1142125887 16:88410091-88410113 ATGTGGGGGTGGGGGAAGGAAGG + Intergenic
1142240635 16:88943148-88943170 ACGTGGGAGTGGGGGCAGGTGGG + Intronic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1203084244 16_KI270728v1_random:1169931-1169953 GTGTGAGAGAGGAGGGAGGAAGG - Intergenic
1203090121 16_KI270728v1_random:1208064-1208086 CTGGGAGTGGGGAGGCAGGAGGG + Intergenic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142621170 17:1166500-1166522 GTGTGGCAGTGGGGCCAGGAGGG + Intronic
1143203730 17:5129337-5129359 CTGTGGGTGGGGAGGAGGGAAGG + Intronic
1143532075 17:7511343-7511365 GTGTGGGAGTGGGAGGAGGAAGG - Intronic
1143815110 17:9506655-9506677 CAGTGGCAGTGGGGGCAGGTGGG - Intronic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144132184 17:12257079-12257101 CTGTGGGAGTGTTGTCAGCAGGG + Intergenic
1144216298 17:13058468-13058490 CTGTGGGCTTGGAGGCACCATGG + Intergenic
1144402345 17:14918385-14918407 CTGTGGGAGCCGATGCATGATGG + Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144577826 17:16440386-16440408 CGGTGGCAGTGGAGCCAGGGTGG + Intergenic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144874910 17:18392448-18392470 CTGTGGGTGGGGAGGAGGGAAGG + Intergenic
1145157315 17:20551973-20551995 CTGTGGGTGGGGAGGAGGGAAGG - Intergenic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146335143 17:31963400-31963422 CTTTGGGAGATGAGGCGGGATGG - Intronic
1146748568 17:35354483-35354505 CTGTGGCAGTGGAGGAGGGGGGG - Intronic
1147185688 17:38712028-38712050 GTGTGGGAGTGATGGCAGGTGGG - Intronic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147350249 17:39836423-39836445 AGGCGGGAGTGGAGGCAGGTGGG + Intronic
1147592828 17:41695910-41695932 GTGTGGGGATGGGGGCAGGAGGG - Intergenic
1147613252 17:41813431-41813453 GTTTGGAAGTGGGGGCAGGAGGG - Intronic
1147689103 17:42304666-42304688 CTGGAGCAGTGGGGGCAGGAGGG - Intronic
1147743513 17:42681779-42681801 AGGTGGGAGTGGGGGCAGGGAGG - Exonic
1147753216 17:42750148-42750170 CTGTGGGGTTGGAGGCTTGAGGG - Intergenic
1148210728 17:45806891-45806913 GGGTGGGAGGGGAGGCAGGCAGG + Intronic
1148346653 17:46907991-46908013 CTGTGGGAGAGCAGGCTGGGGGG + Intergenic
1148393674 17:47291555-47291577 TGGTGGGAGGGGAGGAAGGAGGG + Intronic
1148494519 17:48045366-48045388 CTGTGGGAGGGCAGGCTGGCTGG - Intergenic
1148617403 17:49011579-49011601 CTCTGGAGGTTGAGGCAGGAAGG + Intronic
1149123279 17:53196272-53196294 CTCTGGGAAGAGAGGCAGGATGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149655567 17:58308107-58308129 CAGTGGGAGGGAGGGCAGGAGGG + Intronic
1149895871 17:60427842-60427864 CCAGGGGAGTGGGGGCAGGAAGG - Intronic
1150128526 17:62653734-62653756 CTGTTGGGGAGGAGGGAGGAGGG + Intronic
1150132534 17:62677116-62677138 CTCTGGGGTTGGAGCCAGGAGGG - Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150259298 17:63774998-63775020 CTATAGGAGTGGGGGCAAGAGGG - Intronic
1150308290 17:64105456-64105478 CTGTTGGAGTGGAGGTGTGATGG - Intronic
1151037781 17:70821332-70821354 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1151161217 17:72167355-72167377 CTGTGGAAGCAGTGGCAGGAGGG - Intergenic
1151268210 17:72972926-72972948 CTGTGGTAGGTCAGGCAGGAAGG + Intronic
1151427928 17:74043262-74043284 CTTGGGGAGGGGAGGCAGGGAGG + Intergenic
1151491346 17:74433592-74433614 CGATAGGAGTGGAGGCAGGAAGG + Intronic
1151679346 17:75615391-75615413 CTCTGGGACTGGAGGAGGGAGGG + Intergenic
1151724761 17:75877595-75877617 CTATGGGGGTGTAGGCGGGAGGG - Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151774895 17:76193896-76193918 CTGTGGATGTGGAGGTGGGAGGG - Intronic
1151854178 17:76709970-76709992 CCGGGGGAGTGGGGGTAGGAGGG + Intronic
1151967790 17:77440628-77440650 CTGTGGGAGCGTGGGCAGCAGGG - Intronic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152039065 17:77891627-77891649 CTGTGGGATTGCAGGCAGAAGGG - Intergenic
1152345583 17:79748608-79748630 CTGTGGGGTTGGAGGAGGGATGG + Intergenic
1152352339 17:79790816-79790838 CCGTCCGAGTGGACGCAGGAGGG + Intergenic
1152493897 17:80656913-80656935 CGGTGGGAGAGCAAGCAGGAGGG + Intronic
1152589724 17:81205484-81205506 CAGCGGGAGGGGAGGTAGGAGGG + Intronic
1152724432 17:81938220-81938242 GCGTGGGAGTGGGGGCATGATGG - Intronic
1152754556 17:82081844-82081866 CTGTGGGGGAGGGGGCAGGTGGG + Intronic
1152936078 17:83137572-83137594 CTCTCGGAGTGGGGGAAGGAAGG + Intergenic
1152940816 17:83172238-83172260 GGGTGGGAGTGGGAGCAGGAGGG + Intergenic
1153342410 18:3989027-3989049 GTGCAGCAGTGGAGGCAGGAGGG - Intronic
1153964616 18:10168257-10168279 CTGGGATAGTGGAGGCAGGGTGG + Intergenic
1154158374 18:11960966-11960988 CTGTGAGGGTGGAGAGAGGAGGG + Intergenic
1154158773 18:11964630-11964652 CTCTGGGAGTGGTGGTAGTAGGG - Intergenic
1155208268 18:23579111-23579133 ATGTGGGAGAGAAGGAAGGAAGG - Intronic
1155646008 18:28078579-28078601 ATGAGGGAGTTGAGGCAGGCAGG - Intronic
1157217806 18:45800191-45800213 CTGTGGAGGTGGAGCCAAGATGG - Intergenic
1157341231 18:46780288-46780310 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1157493415 18:48139171-48139193 GTGCGGGAGTGGAGGCAGGAGGG + Intronic
1157637351 18:49171697-49171719 TTGTAGGAGAGGAGGAAGGAGGG - Intronic
1157749385 18:50164739-50164761 CTGTTGGAGGGGTGGCAAGAGGG - Intronic
1157812348 18:50706395-50706417 CTGTGGGGGCGGAGGCGGGGGGG - Intronic
1158088414 18:53681788-53681810 TTCTGTGAATGGAGGCAGGATGG + Intergenic
1159050805 18:63419528-63419550 CTGTGGGATGGGAGGCGGTAAGG - Intronic
1159730892 18:72026202-72026224 GTGTGGGACTGGAGGAAGGTGGG - Intergenic
1160490364 18:79332610-79332632 AGGTGGAAGCGGAGGCAGGAGGG + Intronic
1160514340 18:79470205-79470227 CCCTGGAGGTGGAGGCAGGACGG + Intronic
1160641062 19:137456-137478 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1160831348 19:1106125-1106147 CTGTGGCTGTGGAGGCAGCCGGG + Intronic
1160945978 19:1644286-1644308 CTGGGGGAGTGGAGGCAATGAGG + Intronic
1161028821 19:2048724-2048746 GGGTGGGTGGGGAGGCAGGAGGG - Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161370709 19:3909392-3909414 CGGCAGGAGTGGAGGCAGGCAGG + Intronic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1161447660 19:4327490-4327512 CTGTGGGGGCGGAGCCAGTATGG - Intronic
1161776227 19:6263700-6263722 CCGTGAGAGTGAAGGCAGGAGGG + Intronic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1162353807 19:10167879-10167901 CTTTGGGAGGCGAGGCAGGTGGG + Intronic
1162440350 19:10688527-10688549 CTGGGGGAGAGAAGACAGGATGG - Intronic
1162939180 19:13997756-13997778 TGGTAGGAGTGGAGGCAGGCAGG + Intronic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1162954995 19:14092507-14092529 GGGTGGGAGTAGAGGAAGGAGGG + Exonic
1162955076 19:14092882-14092904 AAGTGGGAGAGGGGGCAGGAGGG + Exonic
1163302955 19:16459279-16459301 ATGGGAGTGTGGAGGCAGGAGGG - Intronic
1163499029 19:17664613-17664635 CAGGCAGAGTGGAGGCAGGAAGG - Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1164097059 19:22021090-22021112 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
1164117231 19:22234312-22234334 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1164245172 19:23422054-23422076 GTGTGGGAGTGAGGGTAGGATGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164808913 19:31140768-31140790 CTCTGGGACTGGAGGCTGCAGGG - Intergenic
1164839249 19:31380271-31380293 CTGCGGGAGGGGAGGTAGGAAGG + Intergenic
1164909313 19:31992796-31992818 CTGAGGGAGGGGAGCCAGGATGG - Intergenic
1165192355 19:34075754-34075776 CTGTGAGGCTGGAGGCAAGATGG - Intergenic
1165431616 19:35776227-35776249 CTGTTGGGGTGGAGTAAGGAAGG - Intronic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166300004 19:41907967-41907989 CTTTGGGAGTGGGGCCAGGCGGG + Intronic
1166322694 19:42028461-42028483 GGGTGGGAGAGGAGACAGGAAGG - Intronic
1166566742 19:43770169-43770191 TTGTGGGAGTGGGAGAAGGATGG - Intronic
1166664302 19:44669579-44669601 TTGGGTGAGTGGAGCCAGGAAGG - Intronic
1166847114 19:45735323-45735345 CTCTGGGATTGCAGGAAGGATGG - Intronic
1167341323 19:48918253-48918275 CTGAGGGAGCCGAGGAAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1167758368 19:51427234-51427256 CTGTGAGAATGGAGGAAGGGAGG + Intergenic
1167951662 19:53032509-53032531 CTGAGGGAGAGAAGGCAGGATGG - Intergenic
1202714102 1_KI270714v1_random:33010-33032 CTGAGGGAGTAGAGGCACAAAGG - Intergenic
925258985 2:2513126-2513148 GCGTGGGAGCGGAGGCAGCACGG - Intergenic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
926120251 2:10237841-10237863 GGCTGGGGGTGGAGGCAGGATGG - Intergenic
926138833 2:10356498-10356520 CTCAGGGAGTGGCTGCAGGATGG - Intronic
927927980 2:27026392-27026414 ATGTGGGAGTGGAGCAGGGAGGG - Exonic
928197593 2:29226661-29226683 ATGTTTAAGTGGAGGCAGGATGG + Intronic
928461169 2:31474200-31474222 CTGTGGTAGTTGAGGCAGGGTGG - Intergenic
928732680 2:34250650-34250672 CTGTGGGAGAAGATGCAGGAAGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
929486301 2:42357948-42357970 CTGTGAGAGTGAAGGAAGGGAGG - Intronic
929782756 2:44967854-44967876 CAGTGTGAGTGCAGGCAGCATGG + Intergenic
930017057 2:46978080-46978102 CTGTGGGAGTGAAGTCTGGTGGG + Intronic
930060252 2:47282594-47282616 CTGTAGGAGTTCAGTCAGGATGG + Intergenic
930536583 2:52652000-52652022 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
930737500 2:54794471-54794493 CTGAGGGAGTAGGGACAGGACGG + Intronic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931423645 2:62151220-62151242 ATGTGAGAGAGGAGCCAGGAAGG - Intergenic
932120816 2:69098074-69098096 GTGTGGGAGTGGAGGTAGGGAGG + Intronic
932430368 2:71670538-71670560 AGGTGGGAGTGGAGAGAGGAGGG - Intronic
932460121 2:71876506-71876528 ATGTGGGAGAGGAGGAAGGTGGG - Intergenic
932485487 2:72081959-72081981 GTGTGGGGGTGGGGGCAGCAGGG - Intergenic
932574208 2:72954009-72954031 CTGTAAGTGGGGAGGCAGGAAGG + Intronic
932574215 2:72954054-72954076 ATGTGGTAGACGAGGCAGGAAGG - Intronic
932873677 2:75428982-75429004 CTGTGGAAGAGGAGGCTGGCTGG + Intergenic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
934465871 2:94262464-94262486 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
934610764 2:95733679-95733701 ATTTGGGGGTGGAGGCAGTATGG - Intergenic
935009362 2:99117821-99117843 CTGTGTGACTGGAATCAGGAAGG + Intronic
935425075 2:102911063-102911085 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
935564280 2:104589989-104590011 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935987732 2:108690831-108690853 CTGGGGAGGTTGAGGCAGGAGGG - Intergenic
936126560 2:109793535-109793557 CTGGGGAGGTTGAGGCAGGAGGG - Intronic
936218133 2:110577933-110577955 CTGGGGAGGTTGAGGCAGGAGGG + Intergenic
936287118 2:111189400-111189422 CTGTGGGACCCAAGGCAGGAGGG - Intergenic
936539871 2:113341332-113341354 AATTGGGAGTGAAGGCAGGAAGG - Intergenic
936692753 2:114912489-114912511 CTGTGAGAAGGGAGGCAAGATGG + Intronic
937263177 2:120599275-120599297 ATGTGGGCGTGAAGGCAGGAGGG + Intergenic
937276109 2:120685244-120685266 CTGGGGGAGAGGCTGCAGGAGGG + Intergenic
937379675 2:121365368-121365390 CTCTGGGAGAGGAGGCAGGAAGG - Intronic
937582036 2:123498903-123498925 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937913466 2:127087530-127087552 CAGCGTGAGTGGAGGCAGCAGGG + Intronic
938096096 2:128465280-128465302 TTGGAGGAGTGGGGGCAGGAAGG - Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939097467 2:137851020-137851042 GTGTGTGTGAGGAGGCAGGACGG + Intergenic
939563927 2:143764636-143764658 CTATGGGAGTGGAAGCTGGAAGG - Intronic
940605890 2:155924024-155924046 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
940992371 2:160110790-160110812 CTGTGAGACGGGAGACAGGAGGG + Intronic
941274842 2:163478292-163478314 ATTGGGGAGTGGAGGCAGGGAGG - Intergenic
941668050 2:168261392-168261414 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
941718389 2:168787360-168787382 CTGTGGCAGTGTAAGCAGTATGG - Intronic
941848264 2:170152710-170152732 GTGTGGGAGTCTAGACAGGAAGG + Intergenic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942277608 2:174334555-174334577 TTGTAGGAAAGGAGGCAGGAGGG - Intergenic
942662198 2:178277775-178277797 CTGGGAGAGTGGAAACAGGAGGG - Intronic
944763613 2:202841787-202841809 ATGCAGGAGTGGAGGCAGGTGGG + Intronic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946463582 2:219891513-219891535 CTTTGAGACTGGAAGCAGGAAGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947104431 2:226653826-226653848 AACTGGGAGTGGAGGCATGAAGG + Intergenic
947274911 2:228379670-228379692 CAGTGGGAGTGAAGTCAGAATGG + Intergenic
947363431 2:229369564-229369586 CTGTGGTGGTGGAGGAGGGAAGG + Intronic
947716142 2:232339760-232339782 TTTTGGGAGCGCAGGCAGGATGG + Intronic
947878094 2:233480915-233480937 CTGCGGGTGAGGAGGAAGGAGGG + Intronic
947937838 2:234023196-234023218 CTATGGGAGAAAAGGCAGGAAGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948163854 2:235845901-235845923 CTCTGGGGGTGCAGGAAGGAGGG - Intronic
948201627 2:236133582-236133604 GTGTGTAAGTGGAGGCATGAGGG - Intergenic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
949027593 2:241773787-241773809 CTCTGGGGGTGGGTGCAGGAGGG - Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169204125 20:3730596-3730618 ATGTGGGGGTGGGGGAAGGAGGG + Intergenic
1169224197 20:3846358-3846380 CTGTGGGAGTGGGAGCGGGCGGG - Intergenic
1169264717 20:4160895-4160917 CTGTGGCTCAGGAGGCAGGATGG + Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169794552 20:9447615-9447637 AAGTGGGAGTGGATGCAGAAAGG + Intronic
1169826111 20:9770544-9770566 CTGGGTGAGTGTAGGCAAGATGG + Intronic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1170231206 20:14048941-14048963 AAGTGGGAGTGGAGCAAGGAGGG + Intronic
1170639248 20:18137558-18137580 CTGTGGGAGAGGGGTCAGCACGG + Intergenic
1171172450 20:23027485-23027507 CTGTGGGAGGAGAGACAGGCAGG - Intergenic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1171999089 20:31758093-31758115 TTGAGGGAGGGGTGGCAGGAGGG - Intronic
1172169575 20:32920838-32920860 CTCTGGGAGGGGAGGTAGGGAGG + Intronic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172843513 20:37915935-37915957 CGCTGAGGGTGGAGGCAGGAGGG - Intronic
1173530880 20:43768622-43768644 CTATGGGAGGGGAGGCATGAGGG - Intergenic
1173876671 20:46376626-46376648 TTGTGGGAGTGAGGACAGGATGG - Intronic
1174292860 20:49521340-49521362 TTTTGGGAGTGGAGCCAAGAGGG - Intronic
1174452413 20:50628541-50628563 CATGGGGAGTGGAGGCAGGAAGG - Intronic
1175086109 20:56460553-56460575 CTGTGGTGGTGCAGACAGGAAGG + Intergenic
1175429626 20:58891997-58892019 CTGTGGGGGGCGAGGCCGGAAGG + Intronic
1175998572 20:62821997-62822019 CCGTGGGAGTGGGGGCTGGTGGG + Intronic
1176094344 20:63333096-63333118 CTGTGGCCGTAAAGGCAGGAGGG - Intronic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1176596871 21:8705668-8705690 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1177276250 21:18916571-18916593 CTGTGGCAGTAGAGGTTGGATGG - Intergenic
1177913209 21:27056474-27056496 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1178208390 21:30497609-30497631 CTTTGGGGGTCGAGGGAGGAGGG - Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178894556 21:36548175-36548197 CTAGGGGAGTGGAGGAAGGGGGG - Intronic
1179154075 21:38834845-38834867 CTGCGGGAGGGGAGGCAGCCAGG - Intergenic
1179326875 21:40355197-40355219 CTATGGGTGTGGAGGCAGCCAGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1180279791 22:10683110-10683132 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180453375 22:15488614-15488636 ATGTGGGAGGTGAGGCAAGATGG - Intergenic
1180587009 22:16901636-16901658 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1180591119 22:16938103-16938125 CTGTGGGAGAGAAGGAAGGGTGG + Intergenic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180871205 22:19148333-19148355 GTGTGGGAGTGGAGCCAAGGTGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1181517487 22:23423521-23423543 CTTTGGCAGTGGAGGCAGGGAGG + Intergenic
1181608746 22:23998785-23998807 CTGTGGGAGAGGACCCAGGTGGG - Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182092104 22:27602830-27602852 CTAAGGGAGTGGCGGCAGTAGGG + Intergenic
1182253165 22:29018071-29018093 GTGTGGGAGGGGAGGGCGGACGG + Intronic
1182295527 22:29309572-29309594 CTGTGGGCGGGGAGGCGGGCAGG + Intronic
1183019885 22:35018553-35018575 CTGTGGGAGGGCAGACAGCAGGG - Intergenic
1183026361 22:35068407-35068429 CTGTGTGTCTGCAGGCAGGAAGG + Intronic
1183412173 22:37661231-37661253 CTATGGGAGTGACAGCAGGATGG - Intronic
1183539086 22:38419293-38419315 CGGGGGGAGGTGAGGCAGGAGGG + Intergenic
1183541028 22:38429568-38429590 GTGTGGGAAGGAAGGCAGGAGGG - Intronic
1183590295 22:38775899-38775921 CTGTGGGGGACGGGGCAGGAGGG + Intronic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183781807 22:40003594-40003616 GTGTGGGGGTGGGGGCAGGCAGG - Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184486667 22:44783839-44783861 CTCTGCGGCTGGAGGCAGGATGG - Intronic
1184685434 22:46094712-46094734 CTGGGTGAGTGGTGGCAGGCAGG + Intronic
1184769668 22:46589853-46589875 CTGAGGGAGGGGAGGCAGTCAGG - Intronic
1184783187 22:46659220-46659242 CTGAGGGAGTGGAGGCTGAGAGG - Intronic
1184840777 22:47051161-47051183 CTGAGGGAGTGGGAGCAGGGAGG + Intronic
1184895283 22:47403069-47403091 GTGTGACAGAGGAGGCAGGAGGG + Intergenic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185116506 22:48941207-48941229 CTGTGGGATATGAGGCAGGCAGG - Intergenic
1185150927 22:49163632-49163654 CATGGGGAGAGGAGGCAGGAAGG + Intergenic
1185179269 22:49349899-49349921 CTCTGGGAGTGGTGGCTGGCAGG - Intergenic
1185361262 22:50408549-50408571 GAGTGGGAGTGGAGGCAGCGGGG + Intronic
949417559 3:3830623-3830645 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
949774870 3:7621516-7621538 CTGGGGGAGGGGACGCACGATGG + Intronic
949865048 3:8540598-8540620 AGGTGGGAGGGGAGGCAGGAAGG + Intronic
949891205 3:8734664-8734686 GTGTGGGCCTGGAGGCAGCAGGG - Intronic
949891829 3:8738973-8738995 TTGTGGGAGAGAAGGCAGGAAGG + Intronic
949919529 3:8990331-8990353 CCGTGGGAGTGGAGACTGGTTGG - Intronic
950047395 3:9957635-9957657 TTGTGGGAGGGGAGGGAGCAGGG - Intergenic
950280241 3:11701031-11701053 TTGTAGGGGTGGTGGCAGGAGGG + Intronic
950398164 3:12750003-12750025 CCGGGGTAGTGGAGGGAGGAGGG + Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
951003644 3:17593115-17593137 CTGAGGGAGAGAAGGCAGGGTGG - Intronic
951650984 3:24951235-24951257 CTTTAGGAGGGGAGGCAGAAAGG + Intergenic
951702874 3:25513509-25513531 AAGTGGGAGAGGAGGCAGAATGG - Intronic
951970726 3:28441604-28441626 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
952384316 3:32828740-32828762 CTTTGGGAGGACAGGCAGGAGGG - Intronic
952841967 3:37654179-37654201 GTGTGTGTGTGGAGGCAGGAGGG - Intronic
953118749 3:40018626-40018648 AGGTGGCAGTGGAAGCAGGAAGG - Intronic
953569075 3:44057342-44057364 CTCTGGGGGTGGAGAGAGGAGGG - Intergenic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954434737 3:50490014-50490036 GTGTGGGAGTGGATTCAGGTGGG + Intronic
954747346 3:52794697-52794719 TGGGAGGAGTGGAGGCAGGAAGG - Intergenic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
955163498 3:56488066-56488088 TAGTGGGAATTGAGGCAGGAGGG - Intergenic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
956359157 3:68428175-68428197 CAGAGGGAGAGGAGGAAGGAAGG + Intronic
956604896 3:71064629-71064651 CTCTGGAAGTGGAGGCGGGGAGG - Intronic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957373744 3:79330159-79330181 ATGTGGCAGTGGAGGCGGGGAGG + Intronic
958061258 3:88484500-88484522 ATATGGGAGTGGAGGATGGATGG + Intergenic
958487650 3:94732211-94732233 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
959038136 3:101388254-101388276 CTGTGGTGGTGGTGGCAGGCTGG - Intronic
959193041 3:103140314-103140336 TTGTGTGTGTGAAGGCAGGAAGG + Intergenic
959295306 3:104528131-104528153 TTGTGGGATGGGGGGCAGGAGGG - Intergenic
959662411 3:108883510-108883532 TTGAGGAGGTGGAGGCAGGAAGG + Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
959997887 3:112698583-112698605 CTGGGGGAGAGAAGGCAGGGGGG - Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960603161 3:119478153-119478175 ATTTGGGGGTGAAGGCAGGAAGG + Intronic
960965424 3:123101051-123101073 CTGGCTGAGTGCAGGCAGGATGG + Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961175075 3:124828497-124828519 CTGGGGTAAGGGAGGCAGGAGGG + Intronic
961393536 3:126570608-126570630 CTGTGTGAGGGGAGGCAGTGAGG - Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
961673074 3:128548944-128548966 CTGTGGGTGTCAAGGAAGGAGGG - Intergenic
962053156 3:131840928-131840950 ATGTGTGGGTGCAGGCAGGAGGG - Intronic
962089722 3:132230491-132230513 ATGTGGGGGTGGAGGCCGGGAGG - Intronic
962174214 3:133135850-133135872 GTTTGGGAGTGGAGGGAGGGTGG + Intronic
962422449 3:135240423-135240445 GTGTGGGATTGGAGGCAAGAAGG + Intronic
962747843 3:138410771-138410793 CTGAGGGAGGGGAGGCAGCCGGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962951104 3:140219683-140219705 CTGTGGAATTGGAGACAGCAGGG + Intronic
963050806 3:141141461-141141483 CTGGGGGGGTGGAGCCAAGATGG - Intronic
963065789 3:141263236-141263258 CTGTGGAAGTGGAGGTAGTAAGG + Intronic
963270520 3:143281620-143281642 CTTTGGCAGGGGAGGCAGCAGGG + Intronic
963433028 3:145233906-145233928 CTGTGGGAGTTCAGTCAGGATGG + Intergenic
963892716 3:150653589-150653611 ATGTGCGGGTGGAGGGAGGAGGG - Intergenic
963974076 3:151461044-151461066 CTCTGGGAGGGAAGGAAGGAAGG + Intergenic
964011878 3:151901402-151901424 CTGTGGCAGTGGGTGCAGGCAGG - Intergenic
964381408 3:156101790-156101812 TTGGGGGAGATGAGGCAGGAAGG - Intronic
964867513 3:161277427-161277449 CTGTGGGAGTTAAGGCAGGCTGG + Intergenic
965226735 3:166000497-166000519 CTGGGGGAGAGAAGGCAGGGAGG + Intergenic
965327644 3:167327671-167327693 CTTTAGGAGGGGAGGCAGGCAGG + Intronic
966029903 3:175333217-175333239 CTGTGGTGGTGGTGGCAGGTTGG + Intronic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967095896 3:186176915-186176937 GTTTGGGCGTGGAGGCAGGCAGG + Intronic
967701111 3:192593188-192593210 GTGTTAGAGAGGAGGCAGGAAGG - Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968456727 4:704188-704210 CCGGGGGAGGGGAGGCAGGGAGG - Intergenic
968502940 4:959548-959570 CTGGGGGCGTGGGAGCAGGAGGG + Exonic
968756234 4:2417835-2417857 CAATGGGGGTGGGGGCAGGACGG + Intronic
968800211 4:2738382-2738404 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
968906979 4:3458231-3458253 CTGGGGGAGAGGAGGCAGGGTGG - Intergenic
969131106 4:4991703-4991725 CACAGAGAGTGGAGGCAGGATGG - Intergenic
969261037 4:6033930-6033952 CTCTGGCAGTGGACTCAGGATGG + Intronic
969432335 4:7162709-7162731 CTTAGGGAGTGGAGGAAGAAGGG + Intergenic
969461828 4:7333113-7333135 GTGTGGCCGTGCAGGCAGGAAGG + Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
970309557 4:14767906-14767928 CTGTGGCATGGGAGGCAGCAAGG - Intergenic
970437793 4:16052265-16052287 CTGTGGGAGTGCAGTGAGTAAGG - Intronic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
972125634 4:35761298-35761320 TAGTTGGAGTGGAGGAAGGAGGG - Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972541659 4:40044144-40044166 CTGTGGCGGTGGCTGCAGGAGGG + Intergenic
972723160 4:41721024-41721046 CAGGGGGAGGGAAGGCAGGAGGG + Intergenic
974124038 4:57673769-57673791 CTGAGGGGGTGGAGGCAGTGAGG + Intergenic
974295141 4:59988474-59988496 CTGTGGGAGTGGGACAAGGAAGG + Intergenic
974372983 4:61041836-61041858 CTGTGGAAGTGGGGGCTGGTAGG - Intergenic
974564819 4:63568572-63568594 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974727245 4:65812785-65812807 CTTGGGGAGAGAAGGCAGGATGG - Intergenic
975386688 4:73767246-73767268 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
975669244 4:76763618-76763640 CAGTGGGAGATGAGGCTGGAAGG + Intronic
975752472 4:77538191-77538213 CAATGAGAGAGGAGGCAGGAAGG + Intronic
975765912 4:77667401-77667423 CTGCAGGAGTGGAGACTGGAAGG - Intergenic
975811611 4:78175746-78175768 CAGTAGGAAGGGAGGCAGGAAGG + Intronic
975996496 4:80321758-80321780 TGGTGGGTGTGGAGACAGGAAGG - Intronic
976221695 4:82761532-82761554 CTGTGGGAATGGAGGCTTCAGGG - Intronic
976913805 4:90344013-90344035 CTTGGGGAGGGGAGTCAGGATGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977937440 4:102823366-102823388 CAGTGGAAGTGGTGGTAGGAGGG + Intronic
979076879 4:116282389-116282411 CTTTGGAAGAGGAGGCAGTATGG - Intergenic
979517462 4:121626384-121626406 ATGTTGGAGAGGGGGCAGGAAGG + Intergenic
980497500 4:133605099-133605121 CTGGGGGAGAGAAGGCAGGATGG + Intergenic
980602230 4:135040283-135040305 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
980684174 4:136203636-136203658 TTGTGGGAGTTCAGGCAGGCTGG - Intergenic
982111555 4:152061046-152061068 AGGTGGAAGGGGAGGCAGGAGGG + Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985677938 5:1242056-1242078 CTTTGGCAGTGGAGACAGAAGGG + Intronic
985877765 5:2613251-2613273 CCCTGGGAGCCGAGGCAGGAGGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985951576 5:3225511-3225533 CTGTGGGAGGAGAAGCAGGCTGG - Intergenic
985988483 5:3536681-3536703 CTGTGGGAGTGTGGACGGGAGGG + Intergenic
986278456 5:6302621-6302643 GTGTGGGAGTTCAGGCAGGCTGG - Intergenic
986742951 5:10719769-10719791 CTGTGGGAGAGAAGGCAGGGTGG - Intronic
987468158 5:18296725-18296747 CTGAGGGAGAGAAGGTAGGATGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988075541 5:26349352-26349374 CAGTGGGCCTGGAAGCAGGAAGG - Intergenic
988160797 5:27516607-27516629 CTGTGGGAGAGAAGGCAGGGTGG + Intergenic
988233262 5:28506826-28506848 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
988494148 5:31730474-31730496 ATGGCGGAGTGGAGGCTGGAGGG - Intronic
988675361 5:33427854-33427876 CTATGGGAGGGGAGGATGGATGG + Intergenic
989261779 5:39426381-39426403 CTAGGGGTGTGGAGGCAGGGAGG + Intronic
989474343 5:41857185-41857207 GTGTGGGAGGGGAAGCAGGGAGG - Intronic
989486353 5:41996095-41996117 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
990237957 5:53788147-53788169 CTGTGGGAGTTTAGGCTGGGGGG + Intergenic
990763709 5:59159234-59159256 CTGGGGGAGTTGAGATAGGAGGG - Intronic
991323380 5:65401911-65401933 ATGTGGTAGTGGAGACAGTAAGG - Intronic
992043220 5:72858421-72858443 AGGTGGGTGTGAAGGCAGGAGGG - Intronic
992438165 5:76774998-76775020 GTATGGGAGCTGAGGCAGGAGGG + Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993367440 5:87050697-87050719 CTAGGGGAGAGGAGGCAGGGTGG + Intergenic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
994029796 5:95128661-95128683 CTGGGGAAGGGGAGGAAGGATGG + Intronic
994926250 5:106120721-106120743 CTGTGAACCTGGAGGCAGGAGGG - Intergenic
995045686 5:107643689-107643711 ATGGGGGAGTGGGGACAGGAAGG + Intronic
995269525 5:110205201-110205223 CTGGGGGAAAGAAGGCAGGATGG + Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995598932 5:113775512-113775534 CTGTGGTACTTGAGCCAGGAGGG + Intergenic
995655957 5:114426072-114426094 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
996815201 5:127566605-127566627 CTCTGGGGGAGGTGGCAGGAAGG - Intergenic
997031187 5:130130739-130130761 CTGAGGGAGTAAAGGCAGTATGG - Intronic
997623572 5:135316647-135316669 CTGTGTGAGTGCATGCACGATGG + Intronic
997836227 5:137195537-137195559 CTGGGGCAGTGGATGAAGGATGG + Intronic
997887797 5:137647278-137647300 CTGTGGGATTGAAGGCATGTTGG + Intronic
998369870 5:141654038-141654060 CTGGGGGATTGGGGGCTGGATGG + Exonic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999359585 5:150971883-150971905 CTCTAGGAGTGGAGGCTGGGAGG - Intergenic
999450209 5:151672207-151672229 AGGTGGGCGTGGAGGCGGGAAGG + Intronic
999467608 5:151822461-151822483 CTGTGGGCGGGGGGTCAGGAGGG - Intergenic
999661004 5:153862807-153862829 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
999692244 5:154158114-154158136 CAGAGGGAGGGCAGGCAGGAAGG - Intronic
1000380092 5:160621125-160621147 CTGTGAGCGTGGAGAAAGGAAGG + Intronic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001173629 5:169444908-169444930 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1001257467 5:170195102-170195124 CTGTGGAATTGGAGCCGGGAGGG - Intergenic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001571481 5:172733185-172733207 CTGGGAGAGAGGAGGCAGGATGG + Intergenic
1001735423 5:173994555-173994577 CAGTGGCAGCGGAGGCAGAATGG + Intronic
1001996536 5:176164921-176164943 CTTTGGAGGTGGAGGCATGAGGG - Intergenic
1002190749 5:177476201-177476223 AGGTGGGGGTGGAGGGAGGAGGG - Intergenic
1002310374 5:178310265-178310287 CCGCAGGAGTGGGGGCAGGACGG + Intronic
1002458211 5:179358051-179358073 CAGTGGGAGTGGGGTGAGGAGGG + Intergenic
1002466514 5:179411440-179411462 CTCTGGGAGGGCAGGCAGGCTGG + Intergenic
1002466857 5:179412461-179412483 CGGTGGGGGGGGAGGGAGGAAGG - Intergenic
1002532012 5:179852889-179852911 CTCAGGAAGTGGAGGCAGGCAGG - Intronic
1002602114 5:180359916-180359938 GAGTGGGAGGGGAGGCAGTAGGG + Intergenic
1002736288 5:181388965-181388987 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1002748409 6:85859-85881 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1002758487 6:183542-183564 CTCTGGGAGTGGGAGCAGAAGGG + Intergenic
1002854817 6:1027332-1027354 CTGGGGAACTGGGGGCAGGAAGG + Intergenic
1002997996 6:2305011-2305033 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1003156692 6:3603139-3603161 CTGTGGGGGTAGTGGCAGGTTGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1004198970 6:13530535-13530557 CTGGGGGATTGCAGGCATGAAGG + Intergenic
1004551668 6:16653895-16653917 CTGTGGGAGAGGAGGCAAAGAGG + Intronic
1004831250 6:19478627-19478649 CTGGGGGAGTGGGGGAAGGCAGG - Intergenic
1005009357 6:21321453-21321475 CTGTGCCAGGGGAGTCAGGAGGG + Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1005394160 6:25364185-25364207 CTCTGGGAGGCCAGGCAGGAGGG - Intronic
1005955638 6:30661577-30661599 CTGTGAGAGTTGAGGTAGAAAGG - Intronic
1006096474 6:31659618-31659640 CTGGGAGACTGGAGGCTGGAGGG - Exonic
1006217709 6:32459635-32459657 CTGTGGGAGGGAACACAGGAGGG - Intergenic
1006224066 6:32521660-32521682 TTGTGGGAGGGGAAGCAGGAGGG - Intronic
1006228066 6:32557701-32557723 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006230657 6:32583850-32583872 TTGTGGGAGGGGAGGCAGGAGGG - Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006373587 6:33659672-33659694 CTGTGGAGGTGGAGGGAGGCTGG - Intronic
1006569164 6:34986379-34986401 GCGTGGCAGTGGAGGAAGGAGGG - Intronic
1006735222 6:36268554-36268576 CTGCGGGACTGGAGGCAGCTGGG - Intronic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007267751 6:40610032-40610054 AAGTGGGAGGGGAGGCAGGGAGG - Intergenic
1007478337 6:42133990-42134012 CTGAGGGAGAAGGGGCAGGAGGG - Intronic
1007835779 6:44672524-44672546 CTGTGGGAGAGGATGGGGGATGG + Intergenic
1008266893 6:49439024-49439046 CTGAGGGAGAGAAGGCAGGGTGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008922592 6:56858208-56858230 CAGAGGGAGAGGAAGCAGGAAGG + Intronic
1010107974 6:72190648-72190670 CTGTGGGGGAGAAGGCAGGGTGG + Intronic
1010489588 6:76459481-76459503 CTGAGGGAGTGAAAGAAGGAAGG - Intergenic
1010562106 6:77363124-77363146 GGGTGGGGGTGGGGGCAGGATGG + Intergenic
1011305590 6:85922909-85922931 CTGTGGGATTTGAGGTATGATGG - Intergenic
1011511211 6:88103355-88103377 ATGTGGGTGGGGAAGCAGGATGG - Intergenic
1011620445 6:89237581-89237603 CTGTTGGAGTGGGGGCATGGCGG - Intergenic
1012847922 6:104413166-104413188 GTCTGGGGGTGGAGGCAGCAAGG - Intergenic
1012920767 6:105219280-105219302 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1012928802 6:105295328-105295350 CAGTAGTAGTGGAGGCAGTAAGG - Intronic
1013236944 6:108205519-108205541 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1013406698 6:109850067-109850089 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1013490837 6:110644797-110644819 CAGGGGGAGGGGAGGCAGGGGGG + Intronic
1014417015 6:121195650-121195672 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1014631672 6:123797063-123797085 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1014884695 6:126765258-126765280 CAAATGGAGTGGAGGCAGGAAGG + Intergenic
1015513342 6:134060890-134060912 CAGTGGGAGGGAAGGCAGGATGG + Intergenic
1016147299 6:140692451-140692473 CTGTGGGGGAGAAGGCAGGGTGG + Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016993880 6:149947487-149947509 AGGTGGGTGAGGAGGCAGGATGG + Intronic
1017004453 6:150020050-150020072 AGGTGGGTGAGGAGGCAGGATGG - Intronic
1017113382 6:150953365-150953387 GTGTGGGGGTGGAGGCAGCCGGG - Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017227778 6:152040827-152040849 CTGGGGGAGAGAAGGCAGGGTGG + Intronic
1017388427 6:153911958-153911980 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1017454942 6:154593249-154593271 CTGGGGGAGGGAAGGCAGGCGGG - Intergenic
1018122899 6:160654958-160654980 CTGGGGGAGGGAAGGCAGGGTGG + Intronic
1018287298 6:162254671-162254693 CTCTGGCAGTGGATGAAGGATGG - Intronic
1018803760 6:167242728-167242750 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1018873860 6:167803429-167803451 CTGTGGGCCTGGAGGCAGAGGGG + Intergenic
1019042446 6:169118413-169118435 CTGTGGGGGTGGAGTGGGGATGG - Intergenic
1019101642 6:169635432-169635454 CTGAGGGAGGGGCCGCAGGAGGG + Intronic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019241386 6:170664493-170664515 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1019341419 7:510645-510667 CTGTGGTGGTGGATGCAGGAGGG + Intronic
1019411925 7:910491-910513 TGGTGGGAGGAGAGGCAGGAGGG - Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019803373 7:3104977-3104999 CAGAGGGAGAGGAGACAGGAAGG - Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1021988843 7:26123187-26123209 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1022012295 7:26319069-26319091 CTGTGTCAGTGGAGGAAGGGAGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023875226 7:44283081-44283103 CTGTGGAGGTGGGTGCAGGAAGG - Intronic
1023906244 7:44523620-44523642 CTTTGGGAGGGCAAGCAGGAGGG + Intronic
1024023837 7:45394612-45394634 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1024224934 7:47319314-47319336 CAGTGGGAGTGGAGGTAGACAGG - Intronic
1024804206 7:53117612-53117634 CTGATGGGGTGGAGTCAGGAAGG + Intergenic
1024884312 7:54124382-54124404 CTGAGGGAGAGAAGGCAGGGTGG + Intergenic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1025603923 7:63025192-63025214 ACTTGGGAGTGGGGGCAGGAGGG - Intergenic
1025996236 7:66529251-66529273 CTGTGGGAGAGGAAGGAGGATGG + Intergenic
1026015761 7:66669456-66669478 CTGTGGGATGGGTGGCAGGGAGG + Intronic
1026612380 7:71871622-71871644 TGGTGGGAGTGGGGGCAGGCAGG - Intronic
1026850428 7:73719893-73719915 CTGGGGCAGAGGAGGCAGCAGGG - Intergenic
1026988200 7:74568157-74568179 CTGTGGGAGAGGAAGGAGGATGG + Intronic
1028290229 7:89056531-89056553 ATCTAGGACTGGAGGCAGGAGGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028458329 7:91062530-91062552 CTGGGGGAGTGGAGCCAAGATGG - Intronic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029316951 7:99724155-99724177 AAGAGGGAGTGGAGGCTGGAAGG - Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1030738305 7:113077617-113077639 CTGTGAAAGTGGGAGCAGGAAGG - Intergenic
1031236857 7:119188287-119188309 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1031493668 7:122420905-122420927 CTGGGGAAGGGGAGGGAGGATGG + Intronic
1031802482 7:126265307-126265329 CTTTGGGAGAGGAGACAGGCAGG - Intergenic
1032082690 7:128867923-128867945 TGATGGGAGTGGGGGCAGGAGGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1034246497 7:149648571-149648593 CTGTGGGAGTGATGACAGCAAGG + Intergenic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034426536 7:151016992-151017014 TTGTGGGGGTGAAGGCAGAAGGG + Intronic
1034499303 7:151439821-151439843 CTGTGCTAGGGGATGCAGGAGGG - Intronic
1034543984 7:151777665-151777687 CTGTGAGGCTGGATGCAGGATGG - Intronic
1034642106 7:152612428-152612450 GTGTGGGGGTGGAGTGAGGATGG - Intergenic
1034737804 7:153445260-153445282 ACGTGGGACTGAAGGCAGGAAGG + Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035283013 7:157788982-157789004 CTTGGGAAATGGAGGCAGGAAGG - Intronic
1035332665 7:158106463-158106485 GTGTGTGTGTGGAGGCAGGGAGG - Intronic
1035345436 7:158193976-158193998 TTTGGGAAGTGGAGGCAGGAGGG + Intronic
1035385620 7:158470702-158470724 CAGTGGGAGGTGAGGCAAGAGGG + Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035481767 7:159192592-159192614 CTGTGGGAGGGAAGGAAGCAGGG + Intergenic
1035506731 8:143602-143624 CTGTGGGAGTTCAGTCAGGCTGG + Intergenic
1035898492 8:3431845-3431867 CTGTGGGCGTGGTGGCAGGCTGG - Intronic
1035969119 8:4227944-4227966 GTGTGGGATTGAATGCAGGATGG - Intronic
1036759336 8:11496568-11496590 CTGTGGCAGGGGCTGCAGGACGG + Intronic
1036778306 8:11628606-11628628 CTGTGGGAATGATTGCAGGAAGG + Intergenic
1037170658 8:15887544-15887566 CTGGGGGAGGGGAGGAAGAAGGG - Intergenic
1037364560 8:18107998-18108020 CTGGGGGAGAGGGGGCAGGGTGG + Intergenic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037974833 8:23201679-23201701 CTATGGGGGTGGAGGCACCATGG + Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038271992 8:26082701-26082723 GTGTGAGTGTGGAAGCAGGAGGG - Intergenic
1038364377 8:26916088-26916110 TGGTGGGAGTGGGGGCAGGTAGG - Intergenic
1038699461 8:29836334-29836356 CTGTGAGGCTAGAGGCAGGATGG - Intergenic
1038781951 8:30575625-30575647 CTGTGGGAGTTGTGGTGGGATGG - Intergenic
1039101734 8:33948710-33948732 CTGTTGGAGTGGTGGCTGGAAGG + Intergenic
1039324140 8:36466265-36466287 ATGGGGGAGAGGAGGCAGGGTGG + Intergenic
1040568904 8:48591194-48591216 CTCTGTGAATGTAGGCAGGAAGG + Intergenic
1040807051 8:51406578-51406600 GTGAGGGACTGGAAGCAGGAAGG - Intronic
1040870269 8:52093510-52093532 CATTGGCAGTGGAGGCAGCAGGG - Intergenic
1040932278 8:52747770-52747792 CTGTGGGCGTGGAGGTTGCAGGG - Intergenic
1041499870 8:58528950-58528972 CTGTGAGAATGGAAGCAGGATGG - Intergenic
1041629546 8:60070913-60070935 CTGAGGTAGTGGAAGCAGGTAGG - Intergenic
1041776488 8:61528720-61528742 CTGTGGGTGAAGGGGCAGGAAGG - Intronic
1042129036 8:65568347-65568369 CTGTGGGAATGGAAGTGGGAAGG - Intergenic
1043475231 8:80599567-80599589 GGGTGGGGGTGGAGGCAGCATGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044487128 8:92766920-92766942 CTGCGGGAGAGAAGGCAGGGTGG + Intergenic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1044906013 8:97003786-97003808 TTGTGGTAGGTGAGGCAGGATGG + Intronic
1045308139 8:100976783-100976805 CAATGGGAGTGGAGACAGGGAGG - Intergenic
1045939199 8:107718074-107718096 CAGAGGGAGTGGAGCCAAGATGG - Intergenic
1046742072 8:117840244-117840266 CTGGGGCAGTGCAGTCAGGAAGG + Intronic
1047507570 8:125491833-125491855 CTGTGTCAGAGGAGGCTGGAGGG + Intergenic
1047599450 8:126411525-126411547 TTCTGGGAGTGCAGGCAGGAGGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048450609 8:134530045-134530067 CTGTGGCATAGCAGGCAGGAGGG + Intronic
1048565627 8:135593718-135593740 TTGTGGAAGCCGAGGCAGGAGGG - Intronic
1049228611 8:141470467-141470489 TTGTTGAAGTGGAGCCAGGAAGG - Intergenic
1049288291 8:141788368-141788390 CTGTGGGCGTGGAGCACGGAGGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1049347759 8:142147847-142147869 GTGTGGGAGTGCAGAGAGGAAGG - Intergenic
1049361145 8:142213062-142213084 GTGAGGGAGGGGAGACAGGAAGG - Intronic
1049600563 8:143505555-143505577 GTGTGGGAGTGGAGTGGGGAGGG - Intronic
1049709940 8:144058939-144058961 CTGTGGGATTTGGGGCCGGAGGG - Intronic
1049844510 8:144793355-144793377 CCGTGGGTGGGGAGGCAGCAAGG + Intergenic
1049998685 9:1053254-1053276 CTGTGGCAGGGCAGGCAGGGTGG - Intronic
1050284815 9:4090251-4090273 CTGTTGGGCTGTAGGCAGGAAGG - Intronic
1050360620 9:4827363-4827385 CTGTGGTAGCTGAGGCTGGAGGG + Intronic
1050398725 9:5228601-5228623 ATGTGGGAGTTGAGTCAGGCTGG + Intergenic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1051220842 9:14846904-14846926 ATGAGGCAGTGGTGGCAGGAGGG - Intronic
1051844687 9:21438253-21438275 ATGTGGATGTGGAGGCATGAGGG + Intronic
1052203696 9:25812598-25812620 CTGTGGGAGTGACAGCAAGAAGG - Intergenic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1052442236 9:28512019-28512041 CTGGGGGAGAGAAGGCAGGATGG + Intronic
1053001271 9:34578380-34578402 CTGGGGGAGGGGAGGCAGAAGGG + Intronic
1053300907 9:36948808-36948830 GAGTTGGAGAGGAGGCAGGAGGG - Intronic
1053393771 9:37753999-37754021 GCGTGCGAGTGGAAGCAGGAAGG - Intronic
1053942913 9:43270278-43270300 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1054811784 9:69440913-69440935 CTGGGGGGGTGGAGCCAAGATGG - Intronic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055307871 9:74949755-74949777 CTGTGTCTTTGGAGGCAGGAAGG + Intronic
1055859661 9:80732901-80732923 CTGTGGGGTGGGAGGCGGGAAGG - Intergenic
1055976610 9:81961651-81961673 CAGTGGGAGTGAAGGAAGCAGGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056615732 9:88164037-88164059 CTGTGGGAGTGGCCTCAGGGAGG - Intergenic
1057092981 9:92276822-92276844 GTGTGGGAGTGGGGACAGCAGGG + Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057448731 9:95137748-95137770 CTCTGAGTGTGGAGGCAGGCAGG + Intronic
1057693796 9:97309772-97309794 CTGTGGGAGTGGGGGAATGGGGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1057810214 9:98251747-98251769 CCCTGGGTGTGCAGGCAGGAGGG + Intronic
1057851480 9:98570131-98570153 GTGAGGGAGTGGAGGCAAGGAGG - Intronic
1058073287 9:100623716-100623738 CTTTGGGAGGCCAGGCAGGAGGG + Intergenic
1058365606 9:104205056-104205078 TTATAGCAGTGGAGGCAGGAAGG + Intergenic
1058590231 9:106557729-106557751 CTCTGAGAATGGAGGCAGGGAGG - Intergenic
1058777598 9:108300354-108300376 CGGTGGGCATGGAGGCATGATGG - Intergenic
1059336821 9:113574375-113574397 CTGTGGAAGTAGAGGCAGCAGGG - Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060223935 9:121780256-121780278 CTGGGGGTGGGGTGGCAGGAGGG - Intronic
1060295385 9:122339581-122339603 CTGGGGGAGGGGAGGCAGGAAGG - Intergenic
1060483049 9:124029210-124029232 CTGTGGCAGTGCATGCTGGAGGG + Intronic
1060491842 9:124090950-124090972 CTTTGGGAGTGCAGGTGGGAGGG + Intergenic
1060663230 9:125416501-125416523 CCCTGGGAGTGGAGGAAGAAGGG - Intergenic
1060820986 9:126661588-126661610 CTGGGGCAGTTGGGGCAGGAGGG - Intronic
1061147749 9:128809540-128809562 CTCTGGGAGAGGAGACAGGCAGG - Exonic
1061166493 9:128925734-128925756 GGGTGGAAGAGGAGGCAGGAGGG - Intronic
1061332525 9:129904716-129904738 CTGTGGGAAAGAAGGCAGGAAGG - Intronic
1061396467 9:130346463-130346485 CGGTGGGGCTGGAGGCAGGGGGG + Intronic
1061539919 9:131272619-131272641 CTGGGGCAGGGGAGACAGGAAGG + Intronic
1061727010 9:132587563-132587585 CTGCGGGGGTAGAGGCAGAAAGG + Intronic
1062003426 9:134228016-134228038 CTGCGGGAGAGCAGGCAGGGAGG + Intergenic
1062017275 9:134297149-134297171 CTGTGTGCCTGGAGCCAGGACGG + Intergenic
1062082900 9:134633886-134633908 CTGAGGGGCTGGAGACAGGAGGG - Intergenic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062315073 9:135963091-135963113 CTGTGGGAGGGGAGGCCAGCAGG + Intergenic
1062446370 9:136597043-136597065 TTGAGGAAGTGGAGGCAGGCAGG + Intergenic
1062446736 9:136598380-136598402 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446763 9:136598478-136598500 CTGGGGGAGTGTGGGCATGAGGG + Intergenic
1062446777 9:136598527-136598549 CTGGGGGAGTGTGGGCATGAGGG + Intergenic
1062446811 9:136598650-136598672 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446825 9:136598699-136598721 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062446839 9:136598748-136598770 CTGGGGCAGTGTGGGCAGGAGGG + Intergenic
1062480324 9:136748036-136748058 CTGTAGAACTGGAGGCTGGAGGG - Intronic
1062554558 9:137108081-137108103 CGGTGGGAGCGGAGGCAGCGGGG - Intronic
1062572095 9:137190447-137190469 CCTTGGGAGAGGAGGGAGGAGGG + Intergenic
1062699734 9:137892627-137892649 CTGTGAGACTGCAGGCAGGAGGG + Intronic
1203601578 Un_KI270748v1:13727-13749 CTGTGGGAGTTCAGTCAGGCTGG - Intergenic
1185612145 X:1399079-1399101 ATGTGGGAAGGGAGGAAGGAGGG + Intergenic
1185656587 X:1690446-1690468 CTGTGGGAGGGGAATGAGGAGGG - Intergenic
1185834360 X:3331147-3331169 CTTTGGGAGCCCAGGCAGGAGGG - Intronic
1186279529 X:7977381-7977403 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1186501599 X:10055262-10055284 CTTTGAGAATGGAGGAAGGAAGG + Intronic
1186518557 X:10185814-10185836 GTGTGGAAATGGAGGCAGCAGGG + Intronic
1186569257 X:10697025-10697047 CTATTGAAGTGGAGGCAGGAGGG - Intronic
1187048072 X:15667824-15667846 CTCTGGGAGCTGAGGCAGGAGGG - Intergenic
1187604899 X:20872125-20872147 CTGAGGGAGAGAAGGCAGGGTGG - Intergenic
1187915752 X:24150483-24150505 CTGCGGGAGGCAAGGCAGGAAGG - Intronic
1187968925 X:24640198-24640220 TGGTGGGAGCGGAGGCTGGATGG - Intronic
1188138247 X:26516343-26516365 AGGTGGAAGGGGAGGCAGGAGGG - Intergenic
1188876693 X:35439532-35439554 TTGTGAGAGAGGAGACAGGAAGG - Intergenic
1189280311 X:39816387-39816409 CTGTGGGCCTAGAGGCAGGCAGG + Intergenic
1189317223 X:40064600-40064622 CTGGGGGAGGGGAGACAAGAGGG + Intronic
1189625767 X:42895262-42895284 CTGGGAGACTGGGGGCAGGACGG + Intergenic
1189701601 X:43719301-43719323 TAGTGGGGGTGGAGACAGGATGG + Intronic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190481715 X:50883973-50883995 TGGTGGGAGTTGGGGCAGGAGGG + Intergenic
1191019423 X:55843221-55843243 CTGGTGGAGTGGATTCAGGAGGG + Intergenic
1191095676 X:56670906-56670928 CTGGGGGAGAGAAGACAGGATGG + Intergenic
1191750377 X:64535881-64535903 CTGGGGGAGAGGAAGCTGGAAGG + Intergenic
1192347215 X:70320675-70320697 GTGTGGGAGTGGAGGCCGAGGGG + Intronic
1192661536 X:73047500-73047522 CTGGGGGAGAGAAGGCAGGGTGG + Intergenic
1192673228 X:73168155-73168177 TTGGGGGAGAGAAGGCAGGATGG + Intergenic
1193326330 X:80182122-80182144 CTCTGGGTGAGCAGGCAGGATGG - Intergenic
1193356283 X:80523384-80523406 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1193447181 X:81619030-81619052 CTGGGGGAGAGAAGGCAGGATGG - Intergenic
1193799031 X:85913426-85913448 CTGGAGGACAGGAGGCAGGAAGG + Intronic
1193832979 X:86310363-86310385 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1193957319 X:87878478-87878500 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1194206623 X:91018718-91018740 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1194466568 X:94240995-94241017 CTGGAGGAGTTGAGGCAAGATGG - Intergenic
1194537313 X:95120379-95120401 CGGATGGAGTGGACGCAGGAGGG + Intergenic
1194833984 X:98659064-98659086 CTGGGGGAGAGAAGGCAGGCTGG - Intergenic
1194978309 X:100414868-100414890 CAGTGGCGGGGGAGGCAGGAAGG - Intergenic
1195365849 X:104124644-104124666 CTTGGGGAGCTGAGGCAGGAGGG + Intronic
1195683082 X:107563255-107563277 CCTTGGGTGTGGGGGCAGGAGGG + Intronic
1195696100 X:107668754-107668776 TGGTGAGAGTGGAGGCAGGAGGG - Intergenic
1195990761 X:110679844-110679866 CAGTGGGATTGCAGGCAGGTTGG + Intronic
1197591895 X:128419645-128419667 CTGGGGGAGAGAAGGCAGGGTGG - Intergenic
1197722439 X:129754623-129754645 GTGTGGCAGTGGGGGCAGGGAGG + Intronic
1198934072 X:141888140-141888162 CTGGGGGAGAGAAGGCAGGGTGG - Intronic
1199095944 X:143738663-143738685 CTGTTGGAGGGGTGGCAAGAGGG + Intergenic
1199681559 X:150228136-150228158 ATGTGGGAGTGGAGGATGGGAGG - Intergenic
1199846332 X:151695077-151695099 CTGGCCGAGTGGAGGAAGGAGGG - Intergenic
1200064899 X:153499648-153499670 CTGTGGGAGTGGCTGCCTGAGGG - Intronic
1200521299 Y:4212287-4212309 CTGAGGGAGAGAAGGCAGGGCGG - Intergenic
1200552371 Y:4593507-4593529 CTGTGGGAGTGGTTTCAGGATGG + Intergenic
1201193688 Y:11471157-11471179 CCGTGGGAGAGAAGGCAGGGTGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic
1201853955 Y:18520327-18520349 CTGTGGGGGTTCAGTCAGGATGG - Intergenic
1201879366 Y:18800057-18800079 CTGTGGGGGTTCAGTCAGGATGG + Intronic
1202086446 Y:21141686-21141708 CTAAGGGTTTGGAGGCAGGAGGG - Intergenic