ID: 1050779740

View in Genome Browser
Species Human (GRCh38)
Location 9:9317736-9317758
Sequence GATCCATGGCTTTGTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050779740_1050779742 -5 Left 1050779740 9:9317736-9317758 CCTGAAGCACAAAGCCATGGATC 0: 1
1: 0
2: 1
3: 9
4: 139
Right 1050779742 9:9317754-9317776 GGATCACCACAGATATAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050779740 Original CRISPR GATCCATGGCTTTGTGCTTC AGG (reversed) Intronic
903015656 1:20360043-20360065 GATTCATTCCTTGGTGCTTCTGG + Intergenic
903680236 1:25091612-25091634 GCTCCATGGCTTTGTGGGTGAGG + Intergenic
908899316 1:68937934-68937956 GATCCATTGCTATGTGACTCTGG - Intergenic
909337871 1:74496971-74496993 GATCCCTGGTTTTCTTCTTCTGG - Intronic
910096491 1:83528402-83528424 GATACAGAGCTTTCTGCTTCAGG + Intergenic
914349267 1:146826304-146826326 GATTCAAGGATTTCTGCTTCTGG + Intergenic
1062891311 10:1062700-1062722 GATTCTTGGCTTTCTGCTTGCGG + Intronic
1065132571 10:22636878-22636900 GAGCCCTGGGTTTGTTCTTCTGG + Intronic
1067910356 10:50340202-50340224 GCTCCTTGGCTTTCTTCTTCAGG + Intronic
1068644825 10:59454355-59454377 GAACCTTGGCTTTCTGCCTCCGG + Intergenic
1068793715 10:61054643-61054665 GATCCAGGGCTCTTTCCTTCTGG - Intergenic
1070875436 10:79802280-79802302 GCTATATGGCTTTGTGCATCCGG - Intergenic
1074278036 10:112023625-112023647 TCTCCAAGGCTTTGTGCTTTAGG - Intergenic
1075353391 10:121746614-121746636 GATCATTGGCTTTGGGCTTTGGG - Intronic
1076288841 10:129328200-129328222 CACACATGGCTGTGTGCTTCAGG - Intergenic
1078459344 11:11501767-11501789 GAGGCTTGGCTTTGTGCTTCTGG + Intronic
1079248567 11:18771160-18771182 TATCCTGGGCTTTGTGCTCCTGG + Intronic
1079420651 11:20284409-20284431 GCTCCATGACTTTGTGTTTTGGG - Intergenic
1083261155 11:61523842-61523864 TGTCCATGGCTTTGAGGTTCCGG + Exonic
1083377656 11:62238890-62238912 GACCCATGGACTTGGGCTTCAGG - Intergenic
1084140791 11:67227379-67227401 GTTCCATGGCCTTCTGATTCAGG + Intronic
1085726479 11:78959483-78959505 GATCCCTGGTTTTGGGTTTCAGG + Intronic
1087725449 11:101710778-101710800 GATCCAGGGCTTTTTTCTGCTGG - Intronic
1088741726 11:112773116-112773138 GATCCATGGATTTGTGAGGCTGG - Intergenic
1090545887 11:127767468-127767490 GATCCATGGCTGTCTTCTTGAGG - Intergenic
1090646511 11:128770819-128770841 GATCCATGCCTAATTGCTTCTGG + Intronic
1095472029 12:42547426-42547448 TATCCATGGCATGGTGCTGCTGG - Intronic
1095581725 12:43807589-43807611 GATTCATGTCCTAGTGCTTCGGG + Intergenic
1096122644 12:49098105-49098127 CATCCTGGCCTTTGTGCTTCAGG - Exonic
1096453179 12:51762535-51762557 GATCCATGGCTATGAGCTTCAGG - Exonic
1100797622 12:98198880-98198902 CATCCTTGGCTTTGTGCTGTTGG + Intergenic
1100888739 12:99100890-99100912 GATCCAAAGCTGTGTACTTCAGG - Intronic
1102770115 12:115468563-115468585 GAGCCATGGCTTTGTTCTTAGGG + Intergenic
1106386059 13:29287301-29287323 TGCCCAGGGCTTTGTGCTTCAGG + Intronic
1107895970 13:44964108-44964130 GATTTATTGCTTTGTGTTTCTGG - Intronic
1108111093 13:47073603-47073625 GATCCATGGCTTTTTTTCTCTGG - Intergenic
1108325148 13:49323257-49323279 GAACACTGGCTTTGTGCATCAGG + Intronic
1108679987 13:52771819-52771841 GATCCATGGGTGTGTGTCTCAGG - Intergenic
1110983615 13:81936365-81936387 CCTCCATGGCTTTCTGCTTTAGG - Intergenic
1114335420 14:21684499-21684521 GATCAATGGATTGGTGTTTCTGG - Intergenic
1117474000 14:56075647-56075669 GATCCCTTGCTGTGTGCCTCTGG + Intergenic
1118907650 14:70034175-70034197 GATCCAGGGCTTTTTGGTTTTGG - Intergenic
1120121022 14:80680319-80680341 AATACCTGGCTTTCTGCTTCAGG - Intronic
1122368478 14:101213520-101213542 CATCCATGGGTTTCTGCCTCAGG - Intergenic
1123194054 14:106599667-106599689 AATACATGGCTGTGTGCTTGCGG + Intergenic
1126197485 15:45948546-45948568 GAGCCATTGCTTTGTGTATCTGG - Intergenic
1126953490 15:53909372-53909394 GAATCATGTCTTGGTGCTTCAGG - Intergenic
1128934064 15:71730582-71730604 GCCCCATGTCTTTGTGTTTCTGG + Intronic
1129940695 15:79494550-79494572 GAAGCAAGGCTGTGTGCTTCTGG + Intergenic
1132346246 15:101110886-101110908 GACCCATCGCTGTGTGGTTCAGG + Intergenic
1132676542 16:1123532-1123554 GAGCCTTGGCTTTGGGCTTCTGG + Intergenic
1133185262 16:4091698-4091720 GATACGTGGCTTTGTGTGTCTGG - Intronic
1133981096 16:10633827-10633849 GATCCAAGGCTTTGAACTTGAGG - Intronic
1135066463 16:19314365-19314387 AATCCATGCCTTTTTGATTCCGG - Intronic
1137686432 16:50390187-50390209 GATCCAAGGCTTTGGGCTCCAGG + Intergenic
1139984769 16:70889250-70889272 GATTCAAGGATTTCTGCTTCTGG - Intronic
1141332065 16:83119945-83119967 TATCCATGGCTCTGCGTTTCTGG - Intronic
1143186129 17:5011564-5011586 GATAGATTGCTTTCTGCTTCCGG + Intronic
1146713721 17:35065639-35065661 GTTCCATGCCTTTGGCCTTCAGG - Intronic
1147793324 17:43026236-43026258 GATCCTAGGCTTTCTCCTTCAGG - Intronic
1147925297 17:43942053-43942075 AATCCATGGCCTTGTGGGTCTGG + Intronic
1148843885 17:50517355-50517377 GATCCATGGGTTTGAGTTTACGG - Exonic
1151210426 17:72540325-72540347 GAGCAGTGGCTTTGTGCTTCGGG + Intergenic
1158322167 18:56275557-56275579 GGACCCTGGTTTTGTGCTTCTGG + Intergenic
1158790099 18:60769009-60769031 GTTCCATGGCTTTGTATTTGAGG - Intergenic
1160094336 18:75857781-75857803 TTACCATGGCTTTGAGCTTCAGG + Intergenic
1160583475 18:79900474-79900496 CCTCCATGGCCTTGTTCTTCTGG + Intergenic
1165750362 19:38255951-38255973 GCTCTATGGCATTGTGCTTGTGG - Intronic
1166043754 19:40217839-40217861 GGTCCAGGGCTGTGGGCTTCTGG - Intronic
925134133 2:1514700-1514722 GATTGAAGGCTGTGTGCTTCTGG - Intronic
935461024 2:103334644-103334666 CATATATGGCTTTGTTCTTCTGG - Intergenic
937098933 2:119253970-119253992 GAGCCAAGGCTGTGTGCCTCAGG + Intronic
939879236 2:147611289-147611311 GATCCCTGTGTTTGTGTTTCTGG - Intergenic
946126617 2:217568306-217568328 GATTGATGGCTGTGTGCATCTGG - Intronic
946334921 2:219030115-219030137 GGCCCATGGCATCGTGCTTCCGG - Exonic
948982337 2:241500779-241500801 GATCCATAGCTTGGTGCTCTGGG + Exonic
1169637017 20:7703521-7703543 TTTCCCTGTCTTTGTGCTTCAGG + Intergenic
1172688303 20:36773661-36773683 GACCCGTGGCCTTGTGTTTCAGG - Exonic
1173746840 20:45444213-45444235 TATCTCTGGCTTTGTGGTTCTGG + Intergenic
1176163052 20:63658276-63658298 GGTCCGTTGCTTTGTGCTCCCGG - Intronic
1179474635 21:41635325-41635347 AATCAAAGGCTTTGAGCTTCTGG + Intergenic
1180043398 21:45291977-45291999 GTTCTATGGATTTCTGCTTCGGG - Intergenic
1184755521 22:46513752-46513774 TATCTATGGCTTTGAGCTTCTGG - Intronic
1184988838 22:48154032-48154054 ACTCCCTGGCTTTGTGCTTTGGG + Intergenic
955113704 3:55975464-55975486 GAAACATGGCCTTGTTCTTCTGG + Intronic
957220666 3:77378536-77378558 GGTACATGACTTTGAGCTTCTGG - Intronic
957942677 3:87024943-87024965 TATCCAAGGCTTTGTGTTTGTGG + Intergenic
960632261 3:119744079-119744101 GATCCATGCCTTTGTCATGCTGG + Exonic
963572958 3:147020508-147020530 GGGCCAAGGCTTTGTGCCTCTGG - Intergenic
965610467 3:170538236-170538258 GATGACTGACTTTGTGCTTCTGG + Intronic
968116501 3:196094502-196094524 GATCTTTTGCTTTGTGCTCCTGG - Intergenic
969923431 4:10562015-10562037 GACTGATTGCTTTGTGCTTCAGG + Intronic
971369182 4:26002074-26002096 CATCCCTGACCTTGTGCTTCAGG + Intergenic
979235686 4:118397738-118397760 GAAGAAAGGCTTTGTGCTTCTGG + Intergenic
979881708 4:125967926-125967948 GATCAATGGTTTTGTGGGTCTGG - Intergenic
980743572 4:136985046-136985068 GACCACTGGCTTTGTGCTTTTGG - Intergenic
982550411 4:156791046-156791068 GCTCTCTGGCTTTGGGCTTCAGG + Intronic
984939112 4:184916200-184916222 GTTGCATGGCTTTGTGCTGATGG + Intergenic
986147116 5:5088796-5088818 TAGCCATGGCTTTGTGTTTCTGG - Intergenic
986499832 5:8387219-8387241 CAGCCATGTCTTTGTGCTTGGGG - Intergenic
991269918 5:64768008-64768030 GATTGGTCGCTTTGTGCTTCTGG - Intronic
991357256 5:65781863-65781885 GATCCTGGTCTTTGAGCTTCAGG - Intronic
992352386 5:75943557-75943579 GAAACATGGCTTTGTGATTTGGG - Intergenic
992715799 5:79510503-79510525 GATTCGTATCTTTGTGCTTCGGG - Intronic
996081247 5:119260792-119260814 GTTCCATGGCTTTGTGAGTCAGG + Intergenic
996920596 5:128763457-128763479 GATCCATGGCTGTGTGCAGGAGG + Intronic
997123683 5:131203110-131203132 GACCTATGGCTTTGTGTTTATGG - Exonic
999078979 5:148826003-148826025 TCACCATGTCTTTGTGCTTCTGG + Exonic
1000967207 5:167672452-167672474 GATCCATGCCTGTGGCCTTCTGG + Intronic
1004010970 6:11686778-11686800 TATACTTGGCTTTGTGATTCTGG - Intergenic
1008039869 6:46785972-46785994 GAGCCCGGGCTTTGTGGTTCCGG - Intergenic
1008500596 6:52177563-52177585 CATCTATGTCTTTATGCTTCTGG - Intergenic
1009197733 6:60707332-60707354 AACTCATGGCTTTGTGTTTCTGG - Intergenic
1010445870 6:75948245-75948267 GCCCCATGGCATTGTGTTTCAGG + Intronic
1011585413 6:88919566-88919588 GATCCTTGGCCTTGGTCTTCTGG + Intronic
1011820493 6:91247631-91247653 GTTCCATGCCTCTTTGCTTCTGG + Intergenic
1012428184 6:99137130-99137152 GCTCCATGGCTTTCTTGTTCAGG + Intergenic
1013118021 6:107116741-107116763 GATGCAGGGCTTGGTTCTTCAGG - Intergenic
1015054102 6:128878462-128878484 GATCCAGGCAATTGTGCTTCTGG + Intergenic
1018169625 6:161134483-161134505 CATCCTTGGCTTAGTGCTTTAGG + Exonic
1019649644 7:2149939-2149961 GAGCCTTGGCTTTGTGCCCCAGG - Intronic
1021161503 7:17278579-17278601 ATTCCCTGGCTTTCTGCTTCTGG - Intergenic
1021560691 7:21966054-21966076 GCTACTTGGCTGTGTGCTTCTGG - Intergenic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1024245939 7:47470742-47470764 TAGCCAAGGCTTTGTGCTCCCGG + Intronic
1024775594 7:52781783-52781805 GTTCCTTGGCTTTGTACTTAGGG - Intergenic
1028834573 7:95360053-95360075 CAACAATGGCTCTGTGCTTCAGG - Exonic
1034572210 7:151965138-151965160 GACACATGGCTTTGGGCTTGGGG - Intronic
1034885131 7:154793500-154793522 GGTTCATGGCTCTGGGCTTCAGG - Intronic
1036136736 8:6168761-6168783 GATCTATGGTTTTCTGTTTCTGG - Intergenic
1039407361 8:37325096-37325118 GATTCCTGGCTTTGTGGATCTGG - Intergenic
1041746681 8:61214769-61214791 GATCCATGTCTCTGTCCTTATGG + Intronic
1044591891 8:93921157-93921179 GATTCATGCCTTTATGCTTATGG - Intronic
1050100091 9:2110108-2110130 TTTCCAGGGCTTTGTACTTCTGG - Intronic
1050779740 9:9317736-9317758 GATCCATGGCTTTGTGCTTCAGG - Intronic
1054711839 9:68518246-68518268 AATCCATGGCTCTGATCTTCTGG + Intronic
1055615338 9:78066415-78066437 GATGAATGGTTTTGTGCATCGGG - Intergenic
1058999328 9:110331900-110331922 GATCCATGGCTTGGGGGTTGGGG + Intronic
1060532192 9:124354501-124354523 GTGCCATGGCCTTGTGCTCCCGG + Intronic
1062401630 9:136375323-136375345 CATCTGTGGCTTTGTCCTTCAGG - Intergenic
1188986490 X:36772904-36772926 GATTCATGGCTGTATGATTCAGG - Intergenic
1190748464 X:53340992-53341014 GTTCCAGGGCTGTGTGCTGCTGG + Intergenic
1192157581 X:68758092-68758114 GATACATGCCTTTGTGCCCCGGG - Intergenic
1196046688 X:111263460-111263482 GTTCCATGGATCTGTGCTCCTGG - Intronic
1198296521 X:135292723-135292745 GAGCCAGGGCTCTGTGCATCTGG - Intronic
1200529539 Y:4317635-4317657 GATCCATGACTTTGTCAGTCAGG + Intergenic
1201797056 Y:17907120-17907142 AATTCATGGCATTGGGCTTCAGG + Intergenic
1201804497 Y:17998865-17998887 AATTCATGGCATTGGGCTTCAGG - Intergenic
1202358425 Y:24076179-24076201 AACCCATGGCATTGGGCTTCAGG + Intergenic
1202512353 Y:25593934-25593956 AACCCATGGCATTGGGCTTCAGG - Intergenic