ID: 1050783025

View in Genome Browser
Species Human (GRCh38)
Location 9:9363044-9363066
Sequence GCACAGTTCCAGAACTCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050783025_1050783027 2 Left 1050783025 9:9363044-9363066 CCTTGAGAGTTCTGGAACTGTGC 0: 1
1: 0
2: 2
3: 5
4: 195
Right 1050783027 9:9363069-9363091 ACAAAGGAAGAATAATTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050783025 Original CRISPR GCACAGTTCCAGAACTCTCA AGG (reversed) Intronic
901532926 1:9864707-9864729 GTACAGTTCCAGGCCTCTGATGG - Intronic
901800115 1:11703684-11703706 GCACAGTGCCAGAGCACCCATGG - Intronic
904647194 1:31976663-31976685 ACAAAGTTCCAGTATTCTCATGG - Intergenic
906293311 1:44633786-44633808 CTACACTTCTAGAACTCTCAGGG + Intronic
911274309 1:95841941-95841963 GCAGAGTACCAGACCTCTTAAGG + Intergenic
912046592 1:105466453-105466475 CCACAAATCCAGAAATCTCACGG + Intergenic
912279536 1:108298321-108298343 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
912288690 1:108396036-108396058 TCAAAGTTCCAGAAATCTCTAGG - Intronic
916516788 1:165525934-165525956 GCACATTGACAGCACTCTCAAGG - Intergenic
917703956 1:177612804-177612826 GCTCAGTTCCAGCCCTGTCAAGG + Intergenic
917856510 1:179105271-179105293 GCTTAGTTCCAGAACTCTCAAGG + Exonic
919337387 1:196254267-196254289 CTATATTTCCAGAACTCTCAGGG - Intronic
921118331 1:212115229-212115251 ACACAGTTCCAGCATTCTTAGGG + Intergenic
922786939 1:228287543-228287565 GCCCCTTTCCAGAAGTCTCAAGG + Intronic
924323159 1:242869639-242869661 GCCACGTTCCAGAACTCTGAGGG + Intergenic
1062922026 10:1287561-1287583 GCATGGCTGCAGAACTCTCACGG - Intronic
1063467414 10:6256132-6256154 GCACAGGCCCTAAACTCTCAGGG - Intergenic
1067736404 10:48854865-48854887 GCACAAATACAGAACTCTTAGGG - Intronic
1068226457 10:54112848-54112870 TTACAGTTCAAGAAGTCTCATGG + Intronic
1070789937 10:79182976-79182998 GTACAGTTCCAGGACCCTCCTGG - Intronic
1081481528 11:43494169-43494191 GCACAGCTCCAGAAATGTCTTGG - Exonic
1082650514 11:55786040-55786062 TCACAGTTCCAGCATTCTGAAGG - Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1086084960 11:82944736-82944758 TCAAAGTTCCAGAAATCTCTAGG + Intronic
1087289795 11:96307859-96307881 GTTCTGTTCCTGAACTCTCATGG - Intronic
1087381411 11:97409117-97409139 GCACAGTTCCTGAGGCCTCAGGG + Intergenic
1093355596 12:18162887-18162909 GTACAGTTCCAGGAGTCTGAAGG - Intronic
1094651610 12:32384043-32384065 GCAGAGTTCCAAAACTTTGAGGG + Intergenic
1095389705 12:41690876-41690898 GCACAGATCCAGGAAGCTCAGGG + Intergenic
1097360561 12:58654633-58654655 TCAAAGTTCCACAACTCTCTAGG + Intronic
1097957803 12:65504429-65504451 CAGCAGTTCCAGAACTCTGAAGG - Intergenic
1098034240 12:66286213-66286235 AGACAGTTCAAGAACTCTCTGGG + Intergenic
1099004030 12:77216043-77216065 TCAAAGTTCCAGAAATCTCAAGG - Intergenic
1100006143 12:89897854-89897876 GCATTGTTCCAGAACACTCCAGG + Intergenic
1100566944 12:95805482-95805504 GCACAGGTCTAGACCTCACAGGG + Intronic
1103464257 12:121129142-121129164 GCCCAGTTCCAGAACTCAAGGGG - Intergenic
1106601591 13:31192177-31192199 GCCCAGTTCCAGAATTTTCTGGG - Intergenic
1106618831 13:31354900-31354922 TCAAAGTTCCACAAATCTCAGGG - Intergenic
1107255512 13:38421503-38421525 GTACAGTTCCAAGAGTCTCAAGG + Intergenic
1107502431 13:40994086-40994108 GAAAAGTTCCAGGACTCTGAAGG + Intronic
1108528990 13:51311448-51311470 ACACAGCTCCTGAATTCTCAAGG + Intergenic
1109285938 13:60408616-60408638 GCAAAGTTCCACAAATCTCTAGG - Intronic
1110969452 13:81742617-81742639 GCAAAGTTCCAGGACTCAGAAGG - Intergenic
1112113225 13:96325646-96325668 GGATGGTTCCAGAACTCCCAAGG - Intronic
1113071117 13:106422585-106422607 CCACTGTTCCAGAACTTTTAAGG - Intergenic
1115277228 14:31622138-31622160 TCAAAGTTCCACAACTCTCTAGG - Intronic
1115497705 14:34023230-34023252 GCACAGTTCTAGAAGTCTAGAGG + Intronic
1118163704 14:63315870-63315892 GCACAGTTCCTGACCTCCTATGG + Intronic
1118657565 14:67968538-67968560 TCAAAGTTCCACAAATCTCAAGG + Intronic
1119021960 14:71123848-71123870 CTAGAGGTCCAGAACTCTCAAGG - Intergenic
1119804727 14:77475352-77475374 GCACATTTCCAGGGCTCCCAGGG + Exonic
1121483907 14:94298896-94298918 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1123043566 14:105500361-105500383 CCACAGAACCAGGACTCTCACGG + Intergenic
1123838414 15:24221309-24221331 GTACAGAGCCAGAATTCTCAAGG + Intergenic
1123847955 15:24323593-24323615 GTACAGAGCCAGAATTCTCAAGG + Intergenic
1123867002 15:24530958-24530980 GTACAGAGCCAGAATTCTCAAGG + Intergenic
1126568906 15:50128833-50128855 GCGGAGTTCGAGAACTCACAAGG + Intronic
1127308833 15:57733377-57733399 ACACAGTGCTAGAATTCTCATGG + Intronic
1128338154 15:66801862-66801884 TCAGAGTTCCAGAACTCAGAAGG + Intergenic
1130671724 15:85918818-85918840 GGACATTTCCATGACTCTCATGG + Intergenic
1131088520 15:89599614-89599636 GTACAGTTCCAGATCTCAGAAGG + Intronic
1135188509 16:20335433-20335455 GACCTGTTCCAGAACTCTCCTGG - Intronic
1137254666 16:46765138-46765160 GCATAGTTCCTGAACTATGAAGG - Intronic
1138895369 16:61198202-61198224 TCAAAGTTCCAGAAATCTCTAGG - Intergenic
1139847481 16:69931224-69931246 CCCCAGTACCAGAACTCACATGG - Exonic
1140226035 16:73078231-73078253 GCACCCTTCCTGAAATCTCAGGG + Intergenic
1141212790 16:81996594-81996616 GTACAGTTCCAGACCACTCCTGG - Exonic
1143277640 17:5723590-5723612 CCTCAGTTCAAGAACTCTCCTGG - Intergenic
1143715689 17:8767053-8767075 CCACAGTTCCAGAACACTCAAGG - Intergenic
1146685698 17:34840215-34840237 GCACAGTTCCAGGCATATCATGG + Intergenic
1147477518 17:40726786-40726808 TCTTTGTTCCAGAACTCTCACGG + Intergenic
1158292615 18:55958139-55958161 GCAAAGCTACAGAACTCTCTGGG + Intergenic
1159761373 18:72430574-72430596 TCACAGTTCCACAAATCTCTAGG + Intergenic
1160173049 18:76570236-76570258 CCCCAGGTCCAGAACTCCCACGG - Intergenic
1163378262 19:16947484-16947506 TCACAGGTCCAGATCTCCCATGG + Intronic
925867481 2:8241494-8241516 GCAAAGGTCCAGAACGTTCAGGG + Intergenic
925950662 2:8906990-8907012 GCAGAGTCCCAGGACTCTAAAGG + Intronic
927380615 2:22475763-22475785 TCACAGTTCCACAAATCTCTAGG - Intergenic
929693312 2:44092636-44092658 GCACAGTTCTAGGAGTCACACGG + Intergenic
930369603 2:50486584-50486606 TTACAGTCCCAGAACTCTAAGGG + Intronic
934165372 2:89289531-89289553 ACACAGTTCCAAAAATCTGATGG + Intergenic
934201902 2:89892931-89892953 ACACAGTTCCAAAAATCTGATGG - Intergenic
935590736 2:104843954-104843976 ACAGAGTTCCAGACCTCTCAGGG + Intergenic
936792232 2:116164054-116164076 TCAAAGTTCCACAACTCTCTAGG - Intergenic
937616881 2:123934795-123934817 ACATAGTACCATAACTCTCAAGG + Intergenic
941174201 2:162177155-162177177 ACAAAATTCCAGAATTCTCATGG - Intronic
943710267 2:191085743-191085765 GAAAACTTCCAGGACTCTCAGGG + Intronic
943915105 2:193621942-193621964 CCAGAGTTCCAAAACTCTCCAGG - Intergenic
945713399 2:213329471-213329493 GCAAAGTTCCACAAATCTCTAGG - Intronic
1170659896 20:18327568-18327590 AAAAACTTCCAGAACTCTCATGG + Intergenic
1173606736 20:44337056-44337078 GCACTGTTGGAGAACGCTCAGGG + Exonic
1174408464 20:50318350-50318372 GCCCATTTCCAGGACTCCCAGGG - Intergenic
1177258291 21:18693709-18693731 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1177394165 21:20511412-20511434 TCAAAGTTCCACAACTCTCTAGG + Intergenic
1177699148 21:24614448-24614470 TCAAAGTTCCACAAATCTCAAGG - Intergenic
1178366438 21:31992503-31992525 GCACAGTTCCAAATCCCCCAAGG - Intronic
1178408167 21:32342390-32342412 CCACAGTTCCAGAAATCACAAGG + Intronic
1179067247 21:38036995-38037017 ACTCAGTTCCAGCACTCCCAAGG - Intronic
1184199837 22:42960733-42960755 GCACAGCTCCAAAACCCTCCTGG - Intronic
1185085891 22:48740865-48740887 GCACAGTCCCAGGGTTCTCAGGG - Intronic
949570841 3:5291523-5291545 GCACAGTTCCCAAACACTTAAGG - Intergenic
951024524 3:17815648-17815670 TGACAGTTCCAGAACTGTCAGGG - Intronic
951224245 3:20102336-20102358 GCTTAGTTCCAGAACTGTGATGG + Intronic
951344668 3:21532960-21532982 ACACAGGTCCAGAAATCTGAGGG + Intronic
952578637 3:34804780-34804802 GTACAGTTCCAGGAGTCTGAAGG - Intergenic
952655718 3:35783004-35783026 CCACAGTTGCAGAACTGCCAAGG - Intronic
952870279 3:37893408-37893430 TCACACTTCCAGAGCTCTCTGGG + Intronic
953068105 3:39493407-39493429 GCCCAGTTTTAGAACTTTCAAGG + Intronic
957872741 3:86109631-86109653 GCACAGTTTTAGAACTGTCCAGG + Intergenic
958963470 3:100533524-100533546 GCAAAGTTGCAGCATTCTCATGG - Intronic
959585087 3:108018358-108018380 CCACAGTTCAAGTACTTTCAAGG - Intergenic
959596666 3:108136491-108136513 GCCCAGTTACAGAACTTTCTGGG + Intergenic
959730084 3:109591155-109591177 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
961191119 3:124962744-124962766 GCACAGTTCCACAATTCCCCAGG + Intergenic
965249810 3:166328282-166328304 TCACAGTTCCACAAATCTCTAGG + Intergenic
965313884 3:167166444-167166466 TCACAGTGCCAGAACTGGCAAGG + Intergenic
965929725 3:174028472-174028494 TCAAAGTTCCACAACTCTCTAGG - Intronic
966935015 3:184701097-184701119 CCAAACTTCCAGGACTCTCATGG - Intergenic
971149621 4:24018017-24018039 TAAAAGTTCCAGAACTCTAAGGG + Intergenic
972193068 4:36618023-36618045 TCAGAGTTCCAGGACTCGCAAGG - Intergenic
972301159 4:37786945-37786967 TCAAAGTTCCAGAAATCTCTAGG - Intergenic
972410677 4:38791085-38791107 ACACAGTTCCAGAACAGCCAAGG + Intronic
977961651 4:103091829-103091851 GCACAGATTTAGAATTCTCAAGG + Intronic
980598469 4:134987733-134987755 TCAAAGTTCCACAAATCTCAAGG - Intergenic
986809004 5:11336101-11336123 GCCCAGTTCCAGAATTTTCTGGG - Intronic
986960412 5:13203476-13203498 TGACAGTTCCAGAAATCTCTAGG + Intergenic
987941121 5:24538757-24538779 GTCCATTTCCAGAATTCTCAAGG - Intronic
988028284 5:25727871-25727893 TCAGAGTTCCACAAATCTCAAGG + Intergenic
989950186 5:50287995-50288017 GCAAAGGATCAGAACTCTCAGGG - Intergenic
990029830 5:51243875-51243897 GCACAATGCCAGAACCATCATGG - Intergenic
991215328 5:64153169-64153191 GCTCAGTTCCAGAACTTTGCTGG + Intergenic
994542874 5:101122028-101122050 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
998808516 5:145942088-145942110 GCTCACTTCCAGAACCCTTAAGG + Intronic
999260404 5:150235011-150235033 AGACAGCTCCAGGACTCTCAAGG - Intronic
1000066617 5:157698655-157698677 AAACAATTTCAGAACTCTCATGG + Intergenic
1000515391 5:162232291-162232313 TCACAGTTCCATAAATCTCTAGG - Intergenic
1001143163 5:169162113-169162135 GCAAGTTTCTAGAACTCTCAAGG - Intronic
1001326945 5:170735692-170735714 CCAGAGTTACAGAGCTCTCAGGG + Intronic
1004417978 6:15442187-15442209 GCAAATTGCCAGAACTCTCCTGG - Intronic
1005443242 6:25894161-25894183 GAACAGCTCCAGACATCTCATGG + Intergenic
1005665143 6:28044820-28044842 GCAGAGTTCCAGTACTCAGATGG - Intergenic
1007675093 6:43587030-43587052 GCACAATGCCAGAACTACCAAGG - Intronic
1007999832 6:46348742-46348764 GGCCATTTCCAGACCTCTCAGGG + Intronic
1008877518 6:56345738-56345760 GCATATTTCCAAAACTCTCCTGG - Intronic
1011152640 6:84290922-84290944 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1013818046 6:114122419-114122441 GCTAAGTTTCAGAACTCCCAGGG + Intronic
1014406918 6:121064177-121064199 GCAAAGTTCCACAAATCTCTAGG - Intergenic
1015668609 6:135661033-135661055 GCACAGTTCCAAATGTCCCATGG - Intergenic
1018914948 6:168127398-168127420 GCAGGGTTTCAGAACTCACAAGG + Intergenic
1019358697 7:594136-594158 CCACAGTTCCAGGACGCCCAAGG - Intronic
1021779860 7:24093209-24093231 GAACAATTCCAAAACTCACATGG - Intergenic
1023485672 7:40683820-40683842 ACAAAGTTCCAGAAATGTCATGG + Intronic
1023650596 7:42364917-42364939 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1024158356 7:46648884-46648906 TCAAAGTTCCAGAACTGTCTAGG + Intergenic
1030098836 7:105926491-105926513 GAACAGTGCCAGAAAACTCAAGG - Intronic
1031160177 7:118157084-118157106 GAAAACTTCCAGGACTCTCATGG - Intergenic
1032517667 7:132519007-132519029 GCACAGTGCCTGGAATCTCAAGG - Intronic
1032870902 7:135984054-135984076 GAAAACTCCCAGAACTCTCATGG - Intergenic
1033072199 7:138214398-138214420 GCCCAGTTACAGAATTCTCTGGG + Intergenic
1033073094 7:138222344-138222366 GCCCAGTTACAGAATTCTCTGGG + Intergenic
1033461183 7:141548947-141548969 GCACTGTTCCAGGCCTCTAAGGG + Intergenic
1033953254 7:146812356-146812378 TCAAAGTTCCAGAAATCTCTAGG - Intronic
1035951889 8:4030892-4030914 TCAAAGTTCCACAACTCTCTAGG + Intronic
1037613311 8:20494894-20494916 GCAGACTTCCAAAACTCACATGG - Intergenic
1040888269 8:52289004-52289026 GGAGAGTTCCTGAACTCTGATGG - Intronic
1041428754 8:57753596-57753618 GTACAGTTGAGGAACTCTCAGGG + Intergenic
1042761441 8:72275947-72275969 TCAAAGTTCCAGAAATCTCTAGG - Intergenic
1043591227 8:81835606-81835628 TCAAAGTTCCAGAAATCTCTAGG + Intronic
1043623695 8:82229246-82229268 TCACAGTTCCACAAATCTCTAGG - Intergenic
1043660531 8:82735615-82735637 TCAAAGTTCCACAAATCTCAAGG - Intergenic
1044182402 8:89211887-89211909 GCACTGCTCCAGAAGTCTAAAGG + Intergenic
1046382497 8:113470250-113470272 GCTCAGTTCCAGAATTTTCTGGG + Intergenic
1048390118 8:133954991-133955013 GCACAAATCCATAACCCTCAAGG + Intergenic
1048895844 8:138991412-138991434 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1050783025 9:9363044-9363066 GCACAGTTCCAGAACTCTCAAGG - Intronic
1051039193 9:12785415-12785437 GCACAGTACCAGAACTTGCCTGG + Intronic
1051358380 9:16260585-16260607 TCACAGTTCCAGAGCAATCAAGG - Intronic
1052877703 9:33579758-33579780 TCACAGTTTCAGAGCTCTCCAGG - Intergenic
1053331789 9:37218156-37218178 ACAAAATTCCAGAACTGTCACGG - Intronic
1056488152 9:87079740-87079762 GCTCAGCTCCAAAAGTCTCATGG + Intergenic
1057645022 9:96865890-96865912 TCAAAGTTCCAGAAATCTCTAGG - Intronic
1058957625 9:109963751-109963773 GCTCACATCCAGAACTCACATGG + Intronic
1060474765 9:123978431-123978453 GCAAGGTTCCAGAAAACTCAGGG + Intergenic
1060476597 9:123991692-123991714 GCAAGGTTCCAGAAAACTCAGGG - Intergenic
1060492641 9:124096197-124096219 GCACAGTTCTAGAATGTTCATGG - Intergenic
1061813313 9:133176609-133176631 GTACAGTTCCAGGACTCTGAAGG + Intergenic
1061873547 9:133533032-133533054 GCACAGTCCCCGAGCTCTCCTGG - Intronic
1062196244 9:135275781-135275803 ACACACTTCCAGCACTTTCATGG + Intergenic
1062564911 9:137159999-137160021 GCACACTGCCAGAACTGTGAGGG - Intronic
1186824426 X:13324815-13324837 GCACACTTCCAGAAGTCCCGGGG - Intergenic
1187072432 X:15901568-15901590 CCACAGTTCCACAAATCTCTAGG + Intergenic
1191021134 X:55861335-55861357 GAAGACTTCCAGAATTCTCAAGG + Intergenic
1192932892 X:75826433-75826455 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1192983632 X:76373123-76373145 GCACAGTTCCAAAACTGTGGTGG + Intergenic
1193393477 X:80956901-80956923 GTACAGTTCCAGGAGTCTGAAGG + Intergenic
1193497374 X:82231452-82231474 TCACAGTTCCACAAATCTCTAGG - Intergenic
1194371911 X:93083940-93083962 GCACAGTGCCAAAACAGTCAGGG - Intergenic
1196548803 X:116996935-116996957 TCAAAGTTCCAGAAATCTCTAGG + Intergenic
1196551953 X:117039084-117039106 GCACAGTTCCAAAACCCATAGGG - Intergenic
1197092485 X:122555719-122555741 TCACAGTTCCACAAATCTCTAGG - Intergenic
1197560600 X:128015577-128015599 TCACAGTTCCACAAATCTCTAGG + Intergenic
1199700586 X:150372811-150372833 GCTCATTTCGAGAACTGTCATGG - Intronic
1200679952 Y:6197973-6197995 GCACAGTGCCAAAACAGTCAGGG - Intergenic