ID: 1050784252

View in Genome Browser
Species Human (GRCh38)
Location 9:9379565-9379587
Sequence AATTTCAGAAGGTTAATTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 499}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050784252_1050784256 14 Left 1050784252 9:9379565-9379587 CCATAAATTAACCTTCTGAAATT 0: 1
1: 0
2: 3
3: 37
4: 499
Right 1050784256 9:9379602-9379624 ATTGAATCTACAGATGAAGTTGG No data
1050784252_1050784257 15 Left 1050784252 9:9379565-9379587 CCATAAATTAACCTTCTGAAATT 0: 1
1: 0
2: 3
3: 37
4: 499
Right 1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050784252 Original CRISPR AATTTCAGAAGGTTAATTTA TGG (reversed) Intronic
901344174 1:8524272-8524294 AATTGTAGAAGGATAATTTAGGG - Intronic
904626492 1:31808359-31808381 AATTTATTAACGTTAATTTAAGG - Intronic
905603718 1:39276777-39276799 CTTTTCTGAAGGTTAATTTCTGG - Intronic
905720261 1:40193948-40193970 AATTTCAGGAGTTTAAAATAAGG + Intronic
906016987 1:42590953-42590975 AATTTAAGAGTGGTAATTTAGGG + Intronic
907064381 1:51465775-51465797 GTAGTCAGAAGGTTAATTTAGGG - Intronic
907294563 1:53441707-53441729 AATGTAGGAAGGTAAATTTATGG + Intergenic
907726941 1:57028770-57028792 AATTTGAGAGAGATAATTTAGGG + Intronic
908776751 1:67648045-67648067 AATTTGAGGATGTTATTTTAAGG + Intergenic
908793615 1:67808904-67808926 AATCTCAGAAAATTATTTTATGG + Intronic
909273534 1:73655026-73655048 AATTTCACAAGTATAAATTATGG - Intergenic
909305732 1:74074198-74074220 ATATTCAGAAGGTTACTTTATGG - Intronic
909677554 1:78254774-78254796 ACTTTCATAAGATTGATTTATGG + Intergenic
909745335 1:79088932-79088954 ATTTTCAGAAAATTAATATATGG + Intergenic
909785687 1:79609615-79609637 AATTTCCCAAAGTTAATTTGGGG - Intergenic
910011041 1:82462627-82462649 AATATTAGAAGGTTTATTTTAGG + Intergenic
910322455 1:85963377-85963399 AATTTAAGAAGGGTAACTTATGG - Intronic
911168784 1:94748409-94748431 AAATACAGTAGGTTAATTTAAGG - Intergenic
911437649 1:97882519-97882541 AATTTGGGAATGTTAATTTGGGG + Intronic
911603847 1:99878043-99878065 AATTTTAAAATTTTAATTTAGGG + Intronic
911780288 1:101868478-101868500 AACTTGAGAAAGATAATTTATGG + Intronic
911884785 1:103284273-103284295 AAATTCAGAATGTCAGTTTATGG + Intergenic
912078441 1:105908392-105908414 ACTTTCAGAAGACTAGTTTAAGG + Intergenic
912112677 1:106362970-106362992 AACTTGAGAATGATAATTTATGG + Intergenic
912690970 1:111804446-111804468 AAACACAGAAGGTTAATTGAAGG - Intronic
912945919 1:114083983-114084005 GGTTTCAGAAGGTACATTTAGGG + Intergenic
913001459 1:114584609-114584631 TATCTCATAAGGTTGATTTAAGG + Exonic
913456910 1:119041946-119041968 AATTTTAGAAGGTTGTTGTAAGG + Intronic
915875028 1:159603504-159603526 TATTTCATAAGGTTACTATAAGG - Intergenic
917632093 1:176900481-176900503 AATTTCATAAGATTAGTTGATGG - Intronic
917826442 1:178826400-178826422 AATGTCTGAAGGTTTATTCATGG - Intronic
918175282 1:182038597-182038619 AAATTCAAAAGGTTATTATATGG - Intergenic
918633443 1:186747251-186747273 AATTTGAGAAAGATGATTTAGGG + Intergenic
918920793 1:190707207-190707229 AATTTCCCAAGGTTAAGCTAAGG - Intergenic
919132675 1:193470954-193470976 TATTTCAAAAGGTTACTTTGTGG - Intergenic
919563423 1:199153438-199153460 AATGTCAGAACTTTAATTTCTGG + Intergenic
921563078 1:216681724-216681746 AATTTTTGAAAGTTAATTAATGG + Intronic
921772793 1:219061927-219061949 ACTTTCAGAAAATTAAATTAAGG + Intergenic
922885103 1:229013745-229013767 AATTTGAGAAGGCAAATTTTGGG - Intergenic
922893576 1:229081645-229081667 AATTACAGAAAGTTATTTTGTGG - Intergenic
924663778 1:246048731-246048753 AACTTCACAAGGTTATTGTAAGG + Intronic
1063302003 10:4858227-4858249 AATTTGAGAAGATCAATTTTAGG + Intergenic
1064338842 10:14468700-14468722 AATTTTAGAAAGTTTATTTTAGG - Intergenic
1064845236 10:19644746-19644768 ACTTTCAGATGGTGAATTTGAGG + Intronic
1065506027 10:26430925-26430947 AAGTTCGGAAGGTGAGTTTATGG + Intergenic
1065573386 10:27095313-27095335 ATTTTCAAAAGGGTAATTAAAGG + Intronic
1065592375 10:27278169-27278191 AATTTCAGAATTTTACTTAAAGG - Intergenic
1067670751 10:48318875-48318897 AATTTCAGAAGGCCAAGTAAAGG + Intronic
1068781096 10:60920126-60920148 AATTTCAGCAGGTGAGTTAAGGG - Intronic
1068828674 10:61468561-61468583 AGTTTCAATAGGTCAATTTAGGG - Intergenic
1069029409 10:63579473-63579495 AATTTTAGAATGTGAATTCAAGG + Intronic
1069432228 10:68347977-68347999 AAGATCACAAGGTTAATTTCAGG + Intronic
1070044144 10:72814024-72814046 AATTTCAGAAGGTTAGATTAGGG - Intronic
1071318991 10:84433241-84433263 AATTTCAGCAAGTTATTTTGAGG - Intronic
1071704707 10:87985016-87985038 AATCTCAGCAAGTTAATTTGTGG + Intergenic
1071873519 10:89819512-89819534 AATTTAAGAGAGATAATTTAGGG - Intergenic
1072788833 10:98303004-98303026 AATTTCAGCAGATGAATTTGAGG + Intergenic
1073620759 10:105045755-105045777 AATTTCATAAGGTTATTGAAAGG + Intronic
1074083774 10:110191231-110191253 GTTTTCAGAAGCTTAGTTTATGG + Intergenic
1075010783 10:118868367-118868389 ATATTCAGAAGGATAATTCAGGG + Intergenic
1075273462 10:121073308-121073330 AGTTTTAGAAAGTTCATTTAGGG + Intergenic
1076297230 10:129395888-129395910 TATTTCTGAAGATTTATTTACGG - Intergenic
1078897860 11:15613769-15613791 AATTTCAGAAGGTTCTTCAAAGG + Intergenic
1079048176 11:17127895-17127917 AGTTTCAGTATGTTAATATAGGG + Intronic
1079225930 11:18604725-18604747 AGCTTCAGAAGGTTATTTTAAGG - Intergenic
1079281197 11:19088659-19088681 AATTTCAGGAGGTTACCCTATGG - Intergenic
1079735246 11:23989578-23989600 AATTTCAGAGGCTTTCTTTATGG - Intergenic
1080787708 11:35490789-35490811 AACTTCATAAGGTTGATTTGAGG - Intronic
1081103277 11:39031882-39031904 AATTTCTGTAAGTTATTTTAGGG - Intergenic
1081228928 11:40560912-40560934 CATTTCAGAGAGTTAATTTAAGG + Intronic
1081276245 11:41152680-41152702 AGTATTAGAAGGTTAAATTATGG - Intronic
1081384392 11:42454202-42454224 AGTTTCAGAACGTGAATTTGGGG - Intergenic
1082681822 11:56182800-56182822 AATTTCGGAAAGTTAATTTAAGG - Intergenic
1082948060 11:58781029-58781051 AACTTGAGAGAGTTAATTTAGGG - Intergenic
1085736491 11:79043586-79043608 AACAACAGAGGGTTAATTTATGG - Intronic
1085771587 11:79330690-79330712 AATTTCACAGGGTTAATTTGCGG - Intronic
1086281735 11:85197564-85197586 AGTTTAAAAAGCTTAATTTAAGG - Intronic
1086557729 11:88131554-88131576 AATTTCTGAACTTTAATCTATGG + Intronic
1086773729 11:90802183-90802205 AATGTGTGAAGGTAAATTTAGGG + Intergenic
1087242381 11:95793683-95793705 AATCTCAGAAGGTTATTGTGAGG - Intronic
1088446772 11:109939074-109939096 AAATTCAGCAGGAAAATTTAGGG + Intergenic
1088476532 11:110245466-110245488 AATCTCAGAATGCTAAATTAGGG + Intronic
1088719986 11:112583938-112583960 TATTTCAGAGGGTTATTGTAAGG - Intergenic
1088789706 11:113213811-113213833 ATTTCAAGAAGGTTAATCTAGGG - Intronic
1089226500 11:116927428-116927450 AATTTCAAAAGGTAGACTTAAGG + Intronic
1089886864 11:121833761-121833783 AATTTCAGAAGGAGAAGATACGG + Intergenic
1090155392 11:124432359-124432381 AAATTCACAAGTTTAATCTATGG - Intergenic
1090679830 11:129043087-129043109 AATTTCAGAAGGGTACCTCAAGG - Intronic
1090934680 11:131330798-131330820 GATTTCAGGATTTTAATTTATGG - Intergenic
1090996656 11:131872231-131872253 ACTTTCTCAAGGTTAATTAAAGG - Intronic
1091418867 12:317261-317283 AATTTCAGAAACTGAGTTTAAGG - Intronic
1092379271 12:7981565-7981587 AATTCCAGAAGGTGGACTTATGG + Intergenic
1092816890 12:12320246-12320268 AATTTTAAAATGTTAAATTACGG - Intergenic
1092950933 12:13502225-13502247 CATTTCATAAGATTATTTTATGG + Intergenic
1093095999 12:14973111-14973133 AATTTGAGCAGGATAATTGAAGG + Intronic
1093146952 12:15577980-15578002 CATTTCAGAAGGTGAACTGATGG - Intronic
1093605027 12:21078757-21078779 AACTTGAGAAAGATAATTTAGGG - Intronic
1093967542 12:25343095-25343117 AATTTAATAAGGTTGAATTAGGG + Intergenic
1094151584 12:27290454-27290476 AGTTTAAGAAAGTTAGTTTAAGG - Intronic
1094173681 12:27520964-27520986 GATTTCAGTATGTTTATTTAAGG + Intergenic
1095119122 12:38393669-38393691 AATCTCAGAAGATAAATTTTGGG + Intergenic
1095368232 12:41434311-41434333 CATTTGAAAAGGCTAATTTAAGG + Intronic
1095953251 12:47792943-47792965 AATTTCAGAGGGTTTACTTCTGG + Intronic
1096886954 12:54727641-54727663 AATTTGAGAAAGATGATTTAGGG - Intergenic
1097136004 12:56856283-56856305 AACATCAGAGAGTTAATTTAAGG + Intergenic
1097237111 12:57547733-57547755 AATTTCAGATACTTAATTTTTGG - Intergenic
1097364234 12:58693416-58693438 AAGTCCAGAAGGTAATTTTAAGG + Intronic
1097407176 12:59203311-59203333 AATTTAAGAAGGTGACTGTATGG + Intergenic
1097449764 12:59722153-59722175 AATTTCAGAAGATGAATTTTAGG - Intronic
1097732395 12:63143914-63143936 ACTTTCAGAGTGTTAAATTATGG - Exonic
1097862128 12:64528316-64528338 AATTTCAAAATGTTGATTTTAGG + Intergenic
1098715252 12:73821911-73821933 AATTTTAGAGGGATGATTTAGGG - Intergenic
1098832981 12:75386120-75386142 AATTTCAGCAAGTTAATTTGTGG + Intronic
1099386369 12:82018320-82018342 AACTTGAGAGGGATAATTTAGGG + Intergenic
1099776772 12:87143319-87143341 AATTTCACAAGGATAATAAATGG + Intergenic
1099844924 12:88017842-88017864 AATTTAAGAGAGATAATTTAAGG + Intronic
1100059409 12:90554995-90555017 AATTCCAGTAGGTTACTTTGTGG - Intergenic
1100857231 12:98768309-98768331 AATATCACAAGCTGAATTTATGG + Intronic
1101142215 12:101808225-101808247 AATTTCAGCAAGTTATTTTGGGG + Intronic
1101457614 12:104853131-104853153 ATTATCAGCAGGTTAATCTAGGG + Intronic
1104455643 12:128909640-128909662 AATTTTAGAAGGTGAATCTCTGG + Intronic
1104548619 12:129734822-129734844 AAATTCAGAAATTTAATTTAGGG - Intronic
1105013851 12:132774036-132774058 AGTTTCAGCAGGTTTATATAAGG - Intronic
1105384837 13:19920160-19920182 TACTTGAAAAGGTTAATTTAGGG - Intergenic
1105477520 13:20740829-20740851 ACTTTTAAAAGGTGAATTTATGG + Intronic
1106110447 13:26772190-26772212 AATTTCAGCATATAAATTTAGGG - Intergenic
1106317906 13:28611459-28611481 AAATTCAGAAGCTAAATTAAAGG + Intergenic
1106425028 13:29619874-29619896 ATTTTCAGTTGTTTAATTTATGG + Intergenic
1106704493 13:32266180-32266202 ACTTTCAGAAGAGTAATTTTAGG - Intronic
1106822822 13:33484916-33484938 AATTTCAAAATATCAATTTAAGG + Intergenic
1106864367 13:33947852-33947874 AACTTGAGAAGGATGATTTAGGG + Intronic
1107274254 13:38658840-38658862 ACCTTCAGAAGGGTGATTTAAGG - Intergenic
1107882713 13:44846703-44846725 AATTGCAGAAGTTTAAATAAAGG - Intergenic
1107971958 13:45651934-45651956 AATTTTAGAAGATTCATTTATGG - Intergenic
1108883903 13:55156146-55156168 AATTTCAGAGAGCTGATTTATGG + Intergenic
1108968570 13:56342728-56342750 AACTTGAGAAAGATAATTTAGGG - Intergenic
1109227149 13:59711072-59711094 TATTTCATAAAGTCAATTTAAGG - Intronic
1109398596 13:61793921-61793943 AATTTAAGAAGCATAATTCATGG - Intergenic
1109404368 13:61878197-61878219 AATTTGAGAGAGATAATTTAGGG + Intergenic
1109502546 13:63256331-63256353 AACTTGAGAATGATAATTTAGGG - Intergenic
1109648738 13:65296199-65296221 AATCTCAGAAGATTATTTTGTGG + Intergenic
1109865494 13:68258396-68258418 AAATTCAGAAGGGTATTATATGG + Intergenic
1110226360 13:73123730-73123752 AATTTCAGAATATAATTTTAGGG + Intergenic
1111041512 13:82755873-82755895 AATGTCAGAAGGATGATTTGAGG + Intergenic
1111351158 13:87033419-87033441 ATATTCAGAAGGTCAATTAACGG - Intergenic
1111385397 13:87520950-87520972 AACTTCAGAGAGATAATTTAGGG + Intergenic
1111392766 13:87619864-87619886 AATTTGAGAATATTAATTTTTGG + Intergenic
1111425006 13:88069045-88069067 AATTTCAGTAGGAAAATTTTTGG + Intergenic
1111472126 13:88696317-88696339 AACTTGAGAGGGGTAATTTAGGG - Intergenic
1111652551 13:91110216-91110238 AATTTCAGAATGACAATTTGGGG + Intergenic
1111920900 13:94410339-94410361 AATTACAGACGGCTAATATACGG - Intergenic
1112570315 13:100588219-100588241 AATTTCAGAAGTTTCACTAATGG + Intronic
1112705647 13:102066593-102066615 AAATTCAGAAGGTTATTGGAGGG - Intronic
1112791490 13:103007360-103007382 TATTTCACAAGGTTATTTTAAGG - Intergenic
1112973008 13:105283889-105283911 AATTACAGAATGTTAAATTTGGG - Intergenic
1113047474 13:106171162-106171184 GATTTGAGAAGGTAAATTAAAGG + Intergenic
1113553910 13:111216035-111216057 GTTTTCAGAAGTTTAATTTATGG + Intronic
1113560475 13:111275473-111275495 ACTTTCAGAATGTTAAGTTCCGG - Intronic
1114911534 14:27205076-27205098 CTTTTAAGAAGGTTAATTTATGG + Intergenic
1115298536 14:31857623-31857645 AATTTGAGAAAGATGATTTAGGG - Intronic
1115684437 14:35780470-35780492 AATTACTGAAGTTTATTTTATGG - Intronic
1115957963 14:38802685-38802707 AATTTCAGAAGGACAAGATATGG + Intergenic
1116699303 14:48218428-48218450 CTATTTAGAAGGTTAATTTAAGG + Intergenic
1117393902 14:55290021-55290043 AAATTCAGGAGGGTGATTTAGGG + Intronic
1117993858 14:61460548-61460570 TATTTCAGAGGGTTACTATAAGG - Intronic
1120354648 14:83415413-83415435 ATTTTCAGAAGGATAAATTAAGG + Intergenic
1120392735 14:83929311-83929333 AACTTGAGAATGATAATTTAGGG + Intergenic
1120448521 14:84634539-84634561 AATTTGAGAAGGATTATTTTTGG - Intergenic
1120727738 14:87963872-87963894 AATTTCAGAAACTAACTTTATGG + Intronic
1123841761 15:24254455-24254477 AATTTCAGACTGATGATTTAGGG - Intergenic
1124465414 15:29935290-29935312 AAGTTTAGAAGGTAAATGTAAGG - Intronic
1124713743 15:32037455-32037477 AATCCCAGAAGGTTATTTTGTGG - Intronic
1124793567 15:32753646-32753668 AATTTCAGCATGTGAATTTTGGG - Intergenic
1125846951 15:42864643-42864665 CATTTCTGAAGGATAATTTTGGG - Intronic
1126512973 15:49501452-49501474 AACTTCAGAGTGATAATTTAGGG + Intronic
1128536592 15:68495857-68495879 AATGTGGGAAGGTAAATTTATGG + Intergenic
1131308181 15:91264313-91264335 AATTTTAGAGAGTTTATTTATGG + Intronic
1131652651 15:94418272-94418294 CATTTCAGAAGCGTAATTTTTGG - Intronic
1131731201 15:95283281-95283303 AACTTGAGAATGTTAATATAAGG + Intergenic
1131783535 15:95886001-95886023 AATTTTAGAAAGTGAATTTTGGG + Intergenic
1133831832 16:9330454-9330476 AACCTCAGAAAGTTAATTCAGGG - Intergenic
1134270562 16:12729294-12729316 AATATTACAAGGTTAATTTGGGG + Intronic
1135468714 16:22710100-22710122 AATTTCAGAACTACAATTTAGGG + Intergenic
1136556955 16:31012576-31012598 AAGTTCACAAGGTTAATAAAGGG + Intergenic
1138215103 16:55197788-55197810 TATTTCAGAAGATGAATGTAAGG + Intergenic
1139142969 16:64290794-64290816 AATTTCATATGGTGAATGTATGG + Intergenic
1139200219 16:64967974-64967996 AAATTCTGAAATTTAATTTATGG - Intronic
1140444081 16:75010503-75010525 ACTTTCAGAAGGATAATTTTTGG + Intronic
1140785129 16:78333833-78333855 CATTTAAGAAGTTTCATTTAAGG + Intronic
1141971489 16:87487117-87487139 ATTTTCAGCAGGTTTATTCACGG + Intronic
1144127482 17:12216624-12216646 AATTTCAGAAAGTTGAATTGAGG - Intergenic
1147563593 17:41523378-41523400 TATTTCATGAGGTTATTTTAAGG + Intergenic
1149333212 17:55607633-55607655 AATTTTAAAAGGTTACCTTAGGG - Intergenic
1150121092 17:62603328-62603350 AATTTCAAAGTTTTAATTTAGGG - Intronic
1153257209 18:3183648-3183670 AATATCAGCAGGTTTATTAAAGG - Intronic
1153440770 18:5117006-5117028 AACTTGAGAAAGATAATTTAGGG + Intergenic
1154380075 18:13841487-13841509 TATTTCAAAAGGTATATTTAGGG - Intergenic
1154467137 18:14657729-14657751 AATTGCAGAAGTTTATTATATGG + Intergenic
1154506646 18:15046623-15046645 AATTTGAGAAAGATGATTTAGGG - Intergenic
1155587397 18:27382796-27382818 ATTTTCAAAAAGTTATTTTAAGG - Intergenic
1155861319 18:30904097-30904119 AACTTCAGAAGTTTTGTTTAAGG + Intergenic
1156015830 18:32546274-32546296 AATTAGAGATGGTTAAATTAGGG - Intergenic
1156442470 18:37205315-37205337 AATGTGAGAAGGTAAGTTTATGG + Intronic
1156872927 18:41968256-41968278 TATTTCTGAAGGTACATTTAAGG + Intronic
1157121399 18:44914687-44914709 ATTTTTAGAAGGTTAATGTCTGG + Intronic
1158022705 18:52862220-52862242 AATTTCCAAAAGTTAATTCAAGG + Intronic
1158030371 18:52956625-52956647 AATTTCAGTAAGTTACTTTGTGG - Intronic
1158707917 18:59810524-59810546 AATATGAGGAGGTGAATTTAAGG - Intergenic
1158778082 18:60611572-60611594 AATTTTAAATGGTTAATTTTTGG + Intergenic
1158964974 18:62614478-62614500 TATTTCTGAAGTTGAATTTAGGG + Intergenic
1159027363 18:63196318-63196340 CATTTTAAAAGGTTCATTTATGG + Intronic
1159860402 18:73641779-73641801 AGTTTTAAAAGGTTAATTGATGG + Intergenic
1160123758 18:76152310-76152332 TACTTCAGAAGGTTAATTATTGG - Intergenic
1160536232 18:79595295-79595317 AATTTCAGCAAGTTATTTTGTGG + Intergenic
1162002676 19:7757289-7757311 AACTTGAGAAAGATAATTTATGG + Intergenic
1164765543 19:30763652-30763674 AATTTCAGAGAGTTACTTTGTGG - Intergenic
1165164644 19:33843410-33843432 AATTTCAGATGTTTAGATTAAGG + Intergenic
1165567664 19:36745154-36745176 CTTTTAAGAAGGTTATTTTAAGG - Exonic
1165666305 19:37631600-37631622 ATTTTGAGAAGGTAATTTTAAGG + Exonic
927380617 2:22475785-22475807 AACTTCAGAGAGATAATTTAGGG + Intergenic
928528328 2:32164612-32164634 AATTTCAGATGGTTGGATTAGGG - Intergenic
928895680 2:36260063-36260085 ATTTTCAGGTGGTAAATTTAGGG - Intergenic
929382567 2:41369607-41369629 AATTTGAGAAAGATGATTTAGGG - Intergenic
929625898 2:43406357-43406379 AATTTCTGAACGCTAATTTCTGG + Intronic
929912674 2:46104203-46104225 ATTATCAGAAGGTTACTTGATGG - Intronic
930409089 2:51000761-51000783 AATTTTAAAATATTAATTTACGG - Intronic
930810982 2:55540619-55540641 AATTTCAGCAAGTTATTTTGTGG - Intronic
932255466 2:70282214-70282236 CATTTTAGAAGGTGAAATTAGGG - Intronic
932521455 2:72418147-72418169 AATTTCAGAGTAATAATTTATGG - Intronic
932639157 2:73425179-73425201 ATTTTGAGAATGTTTATTTAAGG + Intronic
933028827 2:77298712-77298734 AATGTCATGAGGTTAAATTAGGG - Intronic
933181228 2:79229929-79229951 AACTTGAGAGGGATAATTTAGGG + Intronic
934528972 2:95073395-95073417 TTTTTCAGAAGGTTCATTTATGG + Intergenic
934536466 2:95138519-95138541 AATTTCAGAGTGATGATTTAAGG + Intronic
935494185 2:103758195-103758217 AATTTAATAATATTAATTTAGGG - Intergenic
935508866 2:103945872-103945894 AATTTAAGAAGGCTAATTATTGG - Intergenic
935534318 2:104275760-104275782 AATAGCAGAAGGTAAATTTATGG - Intergenic
935798656 2:106670680-106670702 AACTTGAGAAGGATGATTTAGGG + Intergenic
935921277 2:108018150-108018172 AGATTCAGAAGGTTGATTTCAGG + Intergenic
936167256 2:110132330-110132352 CATTTCAGAAGGTTACTAAAAGG + Intronic
936226092 2:110653835-110653857 AATTTTAAAAAGTTATTTTAGGG - Intronic
936379708 2:111973499-111973521 AATTCCAGAATGTTTATTTCTGG + Intronic
938614219 2:132980641-132980663 TATTTCAAAAGGTTAATGTGAGG + Intronic
939052844 2:137329327-137329349 AACTTGAGAAAGATAATTTAGGG + Intronic
939159469 2:138569219-138569241 CATTTCAGGTGGATAATTTATGG + Exonic
939773786 2:146358900-146358922 AATTTCAACATGTGAATTTAAGG - Intergenic
940336654 2:152535938-152535960 AATTTCAGAATTTTTATTTTGGG + Intronic
940512341 2:154632896-154632918 AGTTTCAGAAGGGAAATTTCTGG + Intergenic
940543057 2:155046358-155046380 AACTTCAGAGAGATAATTTAGGG - Intergenic
940688105 2:156879784-156879806 AATTTCAAAAGATTAAATAAAGG - Intergenic
940728362 2:157361507-157361529 AATTTGAGAGAGATAATTTAGGG + Intergenic
940826470 2:158417701-158417723 AATTAGACAAGCTTAATTTATGG - Intronic
941314711 2:163978277-163978299 AATTTCATAAGCTCAATTGAGGG - Intergenic
942247911 2:174024381-174024403 CATTTCACAAGTTAAATTTATGG - Intergenic
942387746 2:175460282-175460304 AATTTGAGAAAGATGATTTAGGG + Intergenic
943057831 2:183005435-183005457 ACTTTAAGAAGGTTCTTTTAAGG - Intronic
943492928 2:188579676-188579698 AATTTCAGAATGGTAAATCAGGG - Intronic
944051910 2:195479279-195479301 AATTTGAGAAGGTTAAGTGAGGG - Intergenic
945582989 2:211620533-211620555 ACTTTTAGAAAGTGAATTTATGG + Intronic
945860136 2:215111904-215111926 ATCTTCAGAAGGTTATTTCATGG - Intronic
946900766 2:224369267-224369289 AATTTCAGCAGGATTTTTTATGG - Intergenic
947015136 2:225611006-225611028 TATATCAAAAGCTTAATTTATGG + Intronic
947022085 2:225690396-225690418 AATTTCAAAAGATTTATTGAGGG + Intergenic
947251766 2:228114562-228114584 CATTTCAGAAGTTTATTCTAAGG + Intronic
1169803885 20:9539712-9539734 AATTCCAGAAAGTTACCTTAAGG + Intronic
1170324935 20:15147187-15147209 TATTTCAGAATTTTAATTCATGG + Intronic
1171058752 20:21934696-21934718 AATGTCAGAAGGTGAATACAAGG - Intergenic
1171855557 20:30339742-30339764 AACTTGAGAATGATAATTTAGGG + Intergenic
1173104381 20:40119223-40119245 AAATTCAGAAGGTGAAATTCTGG - Intergenic
1173263811 20:41460128-41460150 AACTTGAGAAGGATGATTTAGGG + Intronic
1174743769 20:53041164-53041186 AAATCAAGAAGATTAATTTATGG + Intronic
1174871541 20:54187136-54187158 GTTTTGAGAAGGTTAATTTGTGG + Intergenic
1176791220 21:13322478-13322500 AATTTGAGAAAGATGATTTAGGG + Intergenic
1176932235 21:14827559-14827581 ATTTCCAAAAGGTTAGTTTAAGG + Intergenic
1177287532 21:19071698-19071720 AACTTGAGAATGATAATTTAGGG + Intergenic
1177531022 21:22357923-22357945 AAATTCAGAAAGTTAATTTTGGG + Intergenic
1177826901 21:26094281-26094303 AACATCAGGAGGTTTATTTAAGG + Intronic
1177990578 21:28030888-28030910 AATTTGAGAAAGATGATTTAGGG - Intergenic
1178761747 21:35409814-35409836 AAGTTCAGAATGCTAAGTTAGGG - Intronic
1180675988 22:17586973-17586995 AATTTTAGAATGTTAATTTTTGG - Intronic
1182826649 22:33271322-33271344 AAATTCACATGGTTAATATATGG - Intronic
1185361477 22:50410163-50410185 AATTTCAGTAGGTTTATTTTTGG - Intronic
949214950 3:1555232-1555254 TATTTCAGAAGCTAAATATAAGG - Intergenic
949315947 3:2755573-2755595 AATTTCACAAGGTAAATCTTAGG + Intronic
949741973 3:7245971-7245993 AATTTCAGAACATTAATTAGAGG + Intronic
951280749 3:20746294-20746316 CATTTCCTAAGGTTAACTTAAGG - Intergenic
951303659 3:21029540-21029562 AATGTCAGAGGGTGAAATTAGGG + Intergenic
951485852 3:23209154-23209176 AATTGCAGTAGTTTCATTTATGG + Intronic
952091724 3:29894642-29894664 AGCTTCAGCAGGTAAATTTAGGG + Intronic
952128139 3:30327187-30327209 AATCTCAGCAAGTTATTTTATGG + Intergenic
952191947 3:31032684-31032706 AATCCCAGAAGGTTATTTTGTGG - Intergenic
952772438 3:37014320-37014342 CATTTCACAAAGTTAGTTTATGG + Intronic
953671144 3:44963464-44963486 ATTTTCAGTTGGCTAATTTAAGG - Intronic
954766458 3:52921807-52921829 AATTTCTGAACATGAATTTAAGG - Exonic
956681944 3:71789180-71789202 AATTACAGAAGATAAATTTAGGG + Intergenic
956932923 3:74066054-74066076 AATTGCACAAGGTTACTTTTTGG + Intergenic
957761958 3:84570546-84570568 GATTTCAGAAGGAAAATTTTTGG + Intergenic
957913700 3:86657535-86657557 TATTTCAGAAAATTATTTTACGG - Intergenic
957977236 3:87461764-87461786 ACTTTCAGATAGATAATTTAAGG + Intergenic
959390048 3:105762047-105762069 AACTTCAGAGAGATAATTTAGGG + Intronic
959743226 3:109745754-109745776 TATTTCACAAAGTTAATATATGG - Intergenic
960020375 3:112945184-112945206 AATCTCAGCAAGTTATTTTATGG + Intronic
960226087 3:115170393-115170415 AATTTCATAATATAAATTTATGG - Intergenic
960308342 3:116089993-116090015 AATTTTAGAATCTTAATTTAAGG + Intronic
960313436 3:116145677-116145699 AATGTATGATGGTTAATTTATGG - Intronic
961598420 3:128038830-128038852 AATTTCAGATTGTTTATTGATGG - Intergenic
963391226 3:144666080-144666102 AATTTGAGAGAGATAATTTAGGG - Intergenic
963777395 3:149452833-149452855 AACTTGAGAATGATAATTTAGGG - Intergenic
964410726 3:156395041-156395063 AACTTAAGAAAATTAATTTAGGG - Intronic
964422687 3:156520725-156520747 AATTTCAGAAGGCAAGTTTTCGG + Intronic
964928525 3:161986445-161986467 AATTTAAAAAGTTTAAGTTAAGG + Intergenic
964966231 3:162496684-162496706 AACTTCAGAGAGATAATTTAGGG - Intergenic
964968897 3:162535264-162535286 AATCTCAGAAAGATAATTCAAGG - Intergenic
965047244 3:163595055-163595077 AATTTAAGAAAGCTATTTTAGGG - Intergenic
965216129 3:165867251-165867273 AATTGAAGAAGATTTATTTATGG + Intergenic
966153525 3:176891887-176891909 AACTTCAGAGAGATAATTTAGGG + Intergenic
966989119 3:185210693-185210715 AAGTTCAGAAGCTGATTTTAAGG + Intronic
967350179 3:188506283-188506305 ATTTTTAGAAGGTTATTTTGAGG + Intronic
970049455 4:11897295-11897317 AACTTCAGAAAGACAATTTAGGG + Intergenic
970158546 4:13166155-13166177 AATTTCAGAGGGTGAGTTTTAGG + Intergenic
970190263 4:13509312-13509334 AATGTCAGAGTGATAATTTAGGG + Intergenic
970546455 4:17134985-17135007 AATTTTAGAAGTTTAGGTTAGGG - Intergenic
970817258 4:20171820-20171842 AGTTTAGGAAGGTTAATATACGG - Intergenic
970835743 4:20404453-20404475 AGTTTCATAAGGTTAAGTTTTGG + Intronic
970836550 4:20415587-20415609 AATTACAGAAGCTTTATTAATGG + Intronic
971431126 4:26568710-26568732 AAATTCAGAAGCTCATTTTAAGG + Intergenic
971469918 4:27012253-27012275 AAATTCAGAAGATTAGTTAAGGG - Intronic
971969669 4:33605196-33605218 AACTTGAGAAGGATTATTTAAGG - Intergenic
972037228 4:34540771-34540793 AATTTCAGGAGGGAAGTTTATGG + Intergenic
972176529 4:36414051-36414073 AATTTCAGAAGTATAATCAATGG + Intergenic
973019014 4:45176726-45176748 AATTAGAAAACGTTAATTTAAGG + Intergenic
973107707 4:46360937-46360959 AACTTGAGAAGGATTATTTAGGG + Intronic
974010975 4:56606978-56607000 GATTTGAGAAGGTGGATTTATGG + Intergenic
974118159 4:57606191-57606213 AATTTCAAAAATTTAATTTCAGG - Intergenic
974683824 4:65197394-65197416 AAATACAGAAATTTAATTTATGG - Intergenic
974717277 4:65683989-65684011 AATATCAGAAGGTGAGATTATGG + Intergenic
974975257 4:68883725-68883747 AATTTCAGGTGGATAATTAATGG - Intergenic
974993701 4:69126595-69126617 CATTTCAGATGGATAATTAATGG + Intronic
975046164 4:69807213-69807235 AACTTCAGAAAGATGATTTAGGG + Intergenic
975103562 4:70542423-70542445 AATCTCAGCAAGTTATTTTATGG + Intergenic
975311931 4:72913120-72913142 AACTTGAGAAAGATAATTTAGGG + Intergenic
975943299 4:79674250-79674272 AATTTCAGAAGGTACATATGTGG - Intergenic
976801777 4:89000652-89000674 ACTTTAAGAAGGTCAATTTATGG + Intronic
976870589 4:89788603-89788625 ATTTTCAGAATGTTACTTTCTGG - Intronic
978222974 4:106299387-106299409 AATTTAAAATGGTTAATTAATGG - Intronic
978229213 4:106377977-106377999 CATTACAGAAGGTTATTATAGGG - Intergenic
978453568 4:108863562-108863584 AATTTGTGATGGTTAATTTTAGG + Intronic
978693439 4:111545319-111545341 AATTTTAAAAAGTTAATATATGG - Intergenic
978898320 4:113917404-113917426 AGATTCTGAAAGTTAATTTAAGG + Intronic
979070129 4:116192454-116192476 TATCTGAGAAGATTAATTTAAGG - Intergenic
979074199 4:116251613-116251635 ATTTTCTTAAGGTTAATTTCAGG + Intergenic
979235738 4:118398164-118398186 AATGTAGGAAGGTAAATTTATGG - Intergenic
980242273 4:130191914-130191936 AATTTAAGAGGGATAATTTAGGG - Intergenic
980302519 4:131012440-131012462 AAGTTGAGTAGGATAATTTAGGG - Intergenic
980426000 4:132628750-132628772 AATTTGAGAAAGATGATTTAGGG + Intergenic
980614914 4:135206991-135207013 ATCTTCATAATGTTAATTTAGGG + Intergenic
981184313 4:141783003-141783025 AACTTGAGAAAGATAATTTAGGG - Intergenic
981861411 4:149361145-149361167 AATTTGAGAAAGATGATTTAGGG + Intergenic
981880118 4:149600415-149600437 AAATTCAGAAAGTTAAATTGGGG + Intergenic
982014051 4:151135175-151135197 ATTTTCATAAGATAAATTTAAGG + Intronic
982208033 4:153011845-153011867 AACTTCAGAATGATGATTTAGGG - Intergenic
982672054 4:158332968-158332990 AATGTTAGAAGGTTAACTCAAGG - Intronic
983093283 4:163532059-163532081 AATTCCAGCAAGTTATTTTATGG + Intronic
983379047 4:166968052-166968074 AATTTGAGAAAGATGATTTAGGG + Intronic
985423823 4:189810080-189810102 AATTCCAGCTGGTTAATTTAGGG - Intergenic
986055394 5:4131261-4131283 ATTTTCGAAAGGATAATTTAGGG - Intergenic
987226146 5:15843584-15843606 AATTTGAGAAGAGCAATTTATGG - Intronic
988045294 5:25943544-25943566 TATTTCATATGGTTACTTTATGG + Intergenic
988400023 5:30750615-30750637 AATTTCAGAGTGTTGCTTTAAGG + Intergenic
988455099 5:31380610-31380632 AAAATCAGAAGGATATTTTATGG + Intergenic
988924544 5:35976397-35976419 AATTTAAGAAGGATAACTAATGG + Intronic
989774544 5:45187896-45187918 AATTTTAGAATGATAAATTAAGG - Intergenic
990735602 5:58858347-58858369 AATATTAGAATGATAATTTAAGG + Exonic
991031934 5:62090900-62090922 AATTTCAGAAGGTTTGGTTGAGG - Intergenic
991218906 5:64189681-64189703 ATTTTCAGAATCTTAATTTCTGG - Intronic
991561026 5:67953030-67953052 AATCTCAGCAAGTTATTTTACGG - Intergenic
993075955 5:83231702-83231724 TATTTCAGAAGGATAAAGTATGG + Intronic
993309629 5:86313379-86313401 AACTTCAGAGGGATGATTTAGGG + Intergenic
993481671 5:88431537-88431559 AATTTGAGAAAGATGATTTAGGG - Intergenic
993908315 5:93648872-93648894 AATTTCAGATTGTTAACCTATGG + Intronic
994009782 5:94888103-94888125 AACTTGAGATGGATAATTTAAGG + Intronic
994025887 5:95082921-95082943 AATTGGAGAAGGTTACTTCAGGG - Intronic
994283625 5:97937703-97937725 AACTTCAGAATGATAATTTCAGG + Intergenic
994544625 5:101148961-101148983 TATTTCAGAAGAATAATTTCTGG - Intergenic
994709755 5:103253220-103253242 AATTGCAGAAGGTAAGTTTGAGG + Intergenic
995076156 5:107985530-107985552 AATTTAAGAAGGTCCACTTAGGG - Intronic
995285339 5:110382271-110382293 AATCTCAGAAAGTTATTTTGTGG - Intronic
995605059 5:113845285-113845307 AATTTAAGAAGCTTGATTTCTGG - Intergenic
995705365 5:114983332-114983354 AATCTCAGTTGGTTAAATTAAGG - Intergenic
996280866 5:121727362-121727384 AATGTCAGAAGTTTATTTGAGGG + Intergenic
996315146 5:122152931-122152953 AATATCAGAATTTGAATTTAGGG + Exonic
997029020 5:130100698-130100720 AACTTCATAAAGTTAGTTTAAGG - Intronic
997468588 5:134104147-134104169 AATTTCAGAAGGGGAGTTTTTGG + Intergenic
997928308 5:138051080-138051102 TATTTCAGAAGGTTTACTTTTGG - Intronic
998970826 5:147590260-147590282 AATTTTTGAAGTTTTATTTATGG - Exonic
998983456 5:147729438-147729460 AATTTCAAAAGGTTAAAGCAAGG + Intronic
999346175 5:150821248-150821270 AACTTGAGAAGGATGATTTAGGG - Intergenic
999569980 5:152908973-152908995 AATTTTATAAATTTAATTTAAGG - Intergenic
999833177 5:155340312-155340334 GATTTCACAAGGTTGATTTAAGG - Intergenic
1000103049 5:158035101-158035123 AATTTGAGAGAGTTGATTTAGGG + Intergenic
1000226447 5:159266353-159266375 AACTTCAGAAAGATGATTTAGGG + Intronic
1000699771 5:164434377-164434399 AATTTCTGAAGGTTAGTCTAGGG + Intergenic
1001968090 5:175928483-175928505 AATTTCAGCAAGTTATTTTGTGG + Intronic
1002249352 5:177915323-177915345 AATTTCAGCAAGTTATTTTGTGG - Intergenic
1002881331 6:1255039-1255061 AGTTTCAGAAGGTGAAGTTGAGG - Intergenic
1004907082 6:20246224-20246246 AATGTGGGAAGGTAAATTTATGG + Intergenic
1005181393 6:23111176-23111198 AAATTCAAAAGGTTATTATATGG - Intergenic
1005400036 6:25422689-25422711 AATTACAGAAGGAAATTTTATGG + Intronic
1006413362 6:33888816-33888838 AATTTAAGAAGCTCAATGTAGGG - Intergenic
1007952533 6:45885078-45885100 AATTGCAGGAGGGTAATTTTTGG - Intergenic
1008002517 6:46375535-46375557 AATTTCAGAAAGATAAACTAGGG - Intronic
1008386773 6:50900824-50900846 AATTTTAGATTTTTAATTTATGG - Intergenic
1008828060 6:55722976-55722998 AATTTAAACAGGTTTATTTATGG - Intergenic
1009373993 6:62944750-62944772 AATTTTCCAAGATTAATTTAGGG + Intergenic
1009538749 6:64924670-64924692 AATTTGAGAATGATGATTTAGGG - Intronic
1009663883 6:66651374-66651396 AATTTCAATACATTAATTTATGG + Intergenic
1010698363 6:79007758-79007780 CATTTCATAAGATTATTTTAGGG - Intronic
1010819358 6:80395501-80395523 AATTTGAGAAAGATGATTTAGGG + Intergenic
1011801294 6:91019043-91019065 AATTTCAGCATTTTAATTTTGGG + Intergenic
1012704960 6:102512719-102512741 AATTTCAGCAGTTTATTTTGTGG - Intergenic
1013752050 6:113418153-113418175 AATTTTAGAGGGTTCATTTCAGG + Intergenic
1013949459 6:115762303-115762325 ATTTTCATTTGGTTAATTTATGG - Intergenic
1013994798 6:116295717-116295739 AGTTTAAGTAGGTTTATTTAAGG + Intronic
1014034633 6:116751720-116751742 AATTTTAAAAAGTTATTTTAGGG + Intergenic
1014400258 6:120980071-120980093 AAATTCAGAAGCTAAAGTTATGG - Intergenic
1014767074 6:125418971-125418993 AATGTGGGAAGGTAAATTTATGG + Intergenic
1014872940 6:126618884-126618906 ATTGTCAGAAGGTTAATACAGGG - Intergenic
1015054282 6:128881415-128881437 AGGTTTAGAAGGTTAATTTAGGG + Intergenic
1015402398 6:132800805-132800827 GATTTCATAAGGCTACTTTAGGG - Intergenic
1015424468 6:133049756-133049778 CATTTTAGAAGATTAATTGAAGG + Intergenic
1016222374 6:141691105-141691127 AATCTCAGCAAGTTATTTTATGG + Intergenic
1016244739 6:141968386-141968408 AATTTCACATAGTTTATTTATGG + Intergenic
1016492568 6:144623345-144623367 AATTTCCAAAGGTGAATTAAAGG - Intronic
1016918494 6:149267002-149267024 AATTTTAGAAGATTAAAGTAGGG + Intronic
1017395022 6:153988792-153988814 AATTTCAGAATGTCATTTTCTGG - Intergenic
1017501558 6:155030158-155030180 AATTTCAGAAAGTTATCATAAGG - Intronic
1017741576 6:157411231-157411253 AATCTCAAAAGGTTACTGTATGG + Intronic
1018874949 6:167813946-167813968 AATTTCAGAAGATAATTATAAGG - Intergenic
1019790065 7:3005998-3006020 AATTTCACAGGGTTGCTTTAAGG + Intronic
1020587906 7:10094031-10094053 AATTCCAGTAAGTTAATTTGTGG - Intergenic
1021518664 7:21516196-21516218 AAGTTCAGATGCTTAATTTCAGG + Intergenic
1022678314 7:32521493-32521515 AACTTAAGAAAGTTGATTTAGGG + Intronic
1023444760 7:40219789-40219811 AATTTCTTAATTTTAATTTAAGG - Intronic
1023688113 7:42757400-42757422 AATTTCATCTGGTTAACTTAAGG + Intergenic
1024085162 7:45886559-45886581 AAATTCAGAAGGTTAAGAAAGGG + Intergenic
1024255275 7:47536193-47536215 AATTTCAGCTGGTTAACTTGAGG - Intronic
1024755050 7:52519348-52519370 AACTTCAGAATGATAATTTAGGG - Intergenic
1024878643 7:54058130-54058152 AATTCCAGAAGGTTATTCTCTGG + Intergenic
1024915145 7:54490654-54490676 GATTTCAGCACATTAATTTAGGG + Intergenic
1027582006 7:80009209-80009231 AATTCCAGAAACTTATTTTATGG + Intergenic
1027732530 7:81893403-81893425 AATTTCTGAAGTATAATTTTAGG + Intergenic
1027935360 7:84595110-84595132 AATTTCCCAAGGTTAAATCAGGG + Intergenic
1028048685 7:86155442-86155464 AATTTCAAAAGATTGATTTATGG + Intergenic
1028723752 7:94063479-94063501 AATTTCAGTAGATGAATTTCAGG - Intergenic
1028736991 7:94225624-94225646 AATTTCAGAAAGATTATATAGGG + Intergenic
1028808010 7:95051508-95051530 AATCTCAGAAAGTTATTTTGTGG - Intronic
1030032270 7:105380501-105380523 AATTTTAGCATGTTAATTTAGGG - Intronic
1030144170 7:106335811-106335833 AATTCCAAAAAGTTAGTTTAAGG - Intergenic
1030218531 7:107072865-107072887 AATGTAAGAATGGTAATTTAGGG + Intronic
1030356359 7:108547556-108547578 AATATCAGAAAATAAATTTAGGG - Intronic
1030444422 7:109631470-109631492 CATTTCAGAAAGCTATTTTATGG - Intergenic
1031486064 7:122326710-122326732 TATTTTAGAAGTTGAATTTATGG - Intronic
1031843154 7:126771787-126771809 ACTTTCAGTAGGATATTTTAGGG - Intronic
1031953780 7:127920994-127921016 AATTTCATATGGTTAAATTTGGG + Intronic
1032776516 7:135119530-135119552 ATTTTCAGAAGTTAAATTTTGGG - Intronic
1032780236 7:135159439-135159461 ATTCTCAGGAGATTAATTTAAGG - Intronic
1033634887 7:143203001-143203023 TATTTCAGAAGCTTAATATTTGG + Intergenic
1033850223 7:145486075-145486097 AAATCCAGAAAGTTAGTTTAAGG + Intergenic
1035146940 7:156828376-156828398 CATTTCAGAAGGTGAAGTTGAGG - Intronic
1036722881 8:11193710-11193732 AATTACAGCAGGTAATTTTAAGG + Intronic
1038029962 8:23629188-23629210 TATTTCAGGAAGTTAATCTAAGG + Intergenic
1038280506 8:26159831-26159853 AATTTGAGAAAGATGATTTAGGG - Intergenic
1038752507 8:30309116-30309138 AATTCCAGCAGGTTATTTTGTGG - Intergenic
1039108576 8:34017114-34017136 AACTGCAGAAGGTTAGTTTGTGG + Intergenic
1039399430 8:37256621-37256643 TATCTCAGAAGGTTAATGTGAGG - Intergenic
1040905031 8:52459745-52459767 AAATGCAGAAAGTTGATTTAAGG + Intronic
1042072558 8:64952227-64952249 AATCTCAGAAAGTTACTTTGTGG + Intergenic
1043125224 8:76385569-76385591 AATTGCAGAAATCTAATTTATGG - Intergenic
1043199030 8:77339823-77339845 AATTTGAGAGAGATAATTTAGGG + Intergenic
1043305669 8:78791219-78791241 AATTTCAGATGGTTCAATTTGGG - Intronic
1043854569 8:85250046-85250068 CATTTCAGAAGGTTCTTCTATGG - Intronic
1044943662 8:97369764-97369786 AGTTTAAGAAGTTTAATTTGAGG - Intergenic
1045673583 8:104585149-104585171 AGTTGCAGATGGTTAATTTTTGG - Intronic
1045801580 8:106107976-106107998 AATTTCCAAAGGTTAGTTCAAGG + Intergenic
1046026745 8:108733638-108733660 ATTTTCAAAATGTTAAATTAAGG - Intronic
1046381935 8:113462702-113462724 AATATCCAAAGGTTAGTTTATGG - Intergenic
1046547616 8:115670821-115670843 AAAGTCAGCAAGTTAATTTATGG - Intronic
1046749046 8:117907493-117907515 GAATTCAGAATGTTATTTTAAGG - Intronic
1047317773 8:123750221-123750243 AATTTCAAAAAGTAAATTCAGGG - Intergenic
1049010097 8:139881742-139881764 AATTTGAGAAGGTGGTTTTAAGG - Intronic
1050784252 9:9379565-9379587 AATTTCAGAAGGTTAATTTATGG - Intronic
1051689947 9:19700820-19700842 AAATGGAGAAGGTTAATTAAAGG - Intronic
1052269862 9:26616182-26616204 AATTCCAGTAGGTCAAGTTACGG - Intergenic
1052688326 9:31781604-31781626 AATTTGAGAAAGATGATTTAGGG - Intergenic
1052839136 9:33276663-33276685 ATTTCCTGAAGGTTAGTTTATGG + Intronic
1053652107 9:40179017-40179039 AAGTTAAGAAGGTTAATCTCAGG + Intergenic
1054532479 9:66197189-66197211 AAGTTAAGAAGGTTAATCTCAGG - Intergenic
1054824820 9:69562695-69562717 TATTTTTAAAGGTTAATTTAAGG + Intronic
1055195006 9:73579774-73579796 AGAATCAGAAGGTTTATTTAAGG - Intergenic
1055736992 9:79341109-79341131 GGTTTCAGATGGTTAATTTAAGG - Intergenic
1056874212 9:90312365-90312387 ATTTGGAGAAGGTTAATTGATGG + Intergenic
1057625800 9:96675610-96675632 AATTTTAGATGGTTTATCTAAGG - Intergenic
1057988713 9:99744819-99744841 AATTTCACAAGGTTGATGTGAGG - Intergenic
1057997978 9:99837369-99837391 ATTTTCAGAAGAGTAAATTAAGG + Intronic
1058323012 9:103657973-103657995 AACTTGAGAAAGTTGATTTAGGG + Intergenic
1058474419 9:105317376-105317398 ATTTTCAGAAGGTAAGTTTATGG + Intronic
1058474555 9:105318551-105318573 ATTTTCAGAAGGTAAATTTATGG + Intronic
1058532255 9:105917645-105917667 AATTTCTGAAGGTAAATGTTGGG - Intergenic
1058853406 9:109035531-109035553 AATCTCAGCAAGTTAATTTCTGG - Intronic
1059147605 9:111914975-111914997 AGTTTCAGAAGGTTTACTCAGGG - Intronic
1059607108 9:115845364-115845386 AATTTCAGAAGGTTGTTATGCGG + Intergenic
1060278802 9:122202089-122202111 AATTTAATAAGGTGAAGTTAAGG - Intergenic
1060737259 9:126073933-126073955 AATTGCTGAAGGTGGATTTAAGG + Intergenic
1186344067 X:8673177-8673199 AATGCCAAAAGGTAAATTTATGG - Intronic
1186756605 X:12678329-12678351 AATTTTAGAAGGGGAATTTCTGG + Intronic
1187102517 X:16209299-16209321 GATTTCAGAATGTTAATATAGGG + Intergenic
1187555104 X:20344091-20344113 AATTTGAGAAAGATGATTTAGGG + Intergenic
1188235804 X:27729792-27729814 AATTTCAACATATTAATTTAGGG + Intronic
1188314961 X:28662224-28662246 AAGTTCAGAAGCTTAACTTTTGG - Intronic
1189527509 X:41840111-41840133 AATTTCAGGAAGTTACTTTGTGG - Intronic
1189639405 X:43051322-43051344 AAATTCAGAAGGCTAATTCATGG - Intergenic
1189891939 X:45611857-45611879 AATACCAGAAAGTTAATTTGTGG - Intergenic
1191986126 X:66983052-66983074 AACTTGAGAGGGATAATTTAGGG - Intergenic
1192270618 X:69575837-69575859 AACTTCAGAGAGATAATTTAGGG - Intergenic
1193442846 X:81564665-81564687 AACTTCAGAGTGATAATTTAGGG + Intergenic
1194102636 X:89725211-89725233 AATTGCAGAATGTTATTTTGTGG - Intergenic
1194368903 X:93046618-93046640 ATGTTCAGAATGATAATTTAGGG + Intergenic
1194491699 X:94558334-94558356 AATTTCATTATGCTAATTTATGG + Intergenic
1194583853 X:95709353-95709375 GACTTCAGCATGTTAATTTAGGG - Intergenic
1194970978 X:100343659-100343681 TATTTCAGATGCATAATTTATGG - Intronic
1195272522 X:103245995-103246017 AATTTCATAGGGTTGTTTTAAGG - Intergenic
1195341862 X:103914369-103914391 AAATTGAGGAGGCTAATTTAAGG + Intergenic
1195725200 X:107907733-107907755 TATTTCAGAAGAGTAAATTAGGG - Intronic
1195919552 X:109969573-109969595 AATTTCAGAAGGCTTTCTTATGG - Intergenic
1197115299 X:122824974-122824996 AATTTCAACATGTGAATTTAGGG + Intergenic
1197650471 X:129058361-129058383 AATTTCAGAAGCTTAAGAAAGGG + Intergenic
1199329620 X:146543546-146543568 AACTTCAGAATGCTGATTTAGGG - Intergenic
1200455222 Y:3382488-3382510 AATTGCAGAATGTTATTTTGTGG - Intergenic
1200677107 Y:6162951-6162973 ATGTTCAGAATGATAATTTAGGG + Intergenic
1202019789 Y:20452430-20452452 AACTTCAGAGAGATAATTTAGGG + Intergenic