ID: 1050784255

View in Genome Browser
Species Human (GRCh38)
Location 9:9379576-9379598
Sequence ATCCCAATCAAAATTTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 944
Summary {0: 1, 1: 3, 2: 44, 3: 213, 4: 683}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050784255_1050784256 3 Left 1050784255 9:9379576-9379598 CCTTCTGAAATTTTGATTGGGAT 0: 1
1: 3
2: 44
3: 213
4: 683
Right 1050784256 9:9379602-9379624 ATTGAATCTACAGATGAAGTTGG No data
1050784255_1050784257 4 Left 1050784255 9:9379576-9379598 CCTTCTGAAATTTTGATTGGGAT 0: 1
1: 3
2: 44
3: 213
4: 683
Right 1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050784255 Original CRISPR ATCCCAATCAAAATTTCAGA AGG (reversed) Intronic
900425043 1:2573832-2573854 ATCCCAGTCAACATTCCAGCAGG + Intergenic
900672274 1:3862314-3862336 ATCCCTATGAAAATTCCAGCTGG + Intronic
901126616 1:6934013-6934035 ATCCCAATCAAAATCCCAGCAGG - Intronic
901176703 1:7306674-7306696 ATATCAATAAAAATTTCAGCAGG - Intronic
902174893 1:14641628-14641650 CTACCAACCAAAATTTCAGGAGG + Intronic
903146764 1:21378020-21378042 ATCTCAAGCAAAAATTTAGATGG + Intergenic
903277112 1:22229249-22229271 ATCCCAGACAAAATCTGAGAAGG + Intergenic
903403342 1:23075024-23075046 CTCCTAATCAAAATCCCAGAAGG - Intronic
904646240 1:31968879-31968901 ATTCCTATCAAAATTTCAGCTGG + Intergenic
906173587 1:43748849-43748871 ATCCTAATTAAAATTTCAGCAGG + Intronic
906174359 1:43757233-43757255 CTCTCAATCAAAATCCCAGAAGG + Intronic
907154314 1:52319300-52319322 ATCCCAATCAAAATACGAGTAGG + Intronic
907327298 1:53647175-53647197 ATCCAAATCAAAATCCCAGCAGG + Intronic
907683721 1:56589466-56589488 ATTCAAATCAAACATTCAGAAGG - Intronic
907801805 1:57774040-57774062 ATCTCAATCAAAATTACAACAGG - Intronic
908172544 1:61521020-61521042 ATTCCTATGAAAATCTCAGATGG - Intergenic
908949097 1:69537998-69538020 ATTCCAATCAAAATTTTATCAGG + Intergenic
909573461 1:77145632-77145654 ATCCCAATCAAAATCCCAGTAGG + Intronic
910101069 1:83577701-83577723 ATTCAAATAAAAATTTCAGTAGG - Intergenic
910130752 1:83902416-83902438 ACCCCAATCATAAATTTAGAGGG - Intronic
910378446 1:86598698-86598720 ATCCCAATCAAAACTCCAGCAGG + Intergenic
910571649 1:88711798-88711820 ATGGCAGTCAAAATTTCAGGAGG + Intronic
910610174 1:89133161-89133183 AGCTCAGTCAAGATTTCAGAAGG - Intronic
910733925 1:90430997-90431019 ATTCCAGTCAAAATTCCAGTAGG - Intergenic
910925575 1:92394783-92394805 ATCCCTATCAAAATCACAGCAGG + Exonic
910958272 1:92731508-92731530 ATCCCAACCAAAATTTCAGCAGG + Intronic
911012652 1:93297673-93297695 ATCCCAATCAAAATCACAGCAGG + Intergenic
911250066 1:95565532-95565554 ATCTCAATCAAAATTCCAGTAGG - Intergenic
911303225 1:96201754-96201776 AACCCAACCAAAATTTCAAAAGG + Intergenic
911432383 1:97808152-97808174 ATTACAATCAAAATATCAGGAGG - Intronic
911988883 1:104665415-104665437 AGCCCAAACAAAATTTCATAAGG + Intergenic
912637050 1:111306169-111306191 ATTCCAATCAAAATTCCAATGGG + Intronic
912767147 1:112424557-112424579 ATCCCAATCAAAATCCCAACAGG - Intronic
913184646 1:116358639-116358661 ATTCCAATCAAAATCACAGTAGG - Intergenic
913226100 1:116700002-116700024 ACCCCAATCAAAATCCCAGCAGG - Intronic
913342740 1:117775701-117775723 AGCCCAATCAAAATCCCAGCAGG + Intergenic
913412463 1:118568122-118568144 ATCTCAATCAAAATGGCAAAAGG + Intergenic
913477108 1:119248627-119248649 AATCCAATCAAAAGTTGAGATGG + Intergenic
913535537 1:119768642-119768664 ATCCCACTCAAAATTTGGCAAGG - Intronic
914326436 1:146621463-146621485 ATCTCAAAGAAACTTTCAGAAGG - Intergenic
914736392 1:150421463-150421485 ATCCCAGTCAAAATCTCAGTAGG + Intronic
915183714 1:154085586-154085608 ATCCCTATCAAAATCTCTGCTGG + Intronic
915407770 1:155674519-155674541 GACCCAATAAAAATATCAGAAGG + Intronic
915415643 1:155740588-155740610 ATCATTATCAAAATTTCAGAAGG + Intergenic
915613796 1:157018282-157018304 ATCCCAATCATAATCTCAGAAGG + Intronic
915714980 1:157936759-157936781 ATCCCAATAAAAAGTTCACCTGG - Intergenic
916371779 1:164105541-164105563 ATACCAATCAAAATATCAATGGG + Intergenic
917551663 1:176038345-176038367 ATGGCAATCAAAATCTCAGCAGG + Intronic
917554760 1:176072449-176072471 ATCCCAGGCAAAATTTGGGAAGG + Intronic
917833956 1:178925668-178925690 ACCCCATTCAAAAATTCATATGG + Intergenic
918138118 1:181695328-181695350 ATCCCCATCAAAATTCTAGCAGG + Intronic
918719425 1:187834341-187834363 ATCCCAATCAAAATTGAAGCAGG + Intergenic
918911740 1:190581681-190581703 ATCCAAATTCAAATCTCAGACGG - Intergenic
919585177 1:199429479-199429501 ATCCCTATCAAAATCCCAAATGG + Intergenic
919681570 1:200440715-200440737 ATCCCAATCAAAATAACAATAGG + Intergenic
920723103 1:208407185-208407207 ATCACAATCAAAATTTCAGCAGG + Intergenic
920752397 1:208691778-208691800 ACTCCAATAAAAATGTCAGATGG - Intergenic
921040977 1:211431991-211432013 ATAACAATCTAAATTTCAAATGG - Intergenic
921980633 1:221253915-221253937 ATCCCTATCAAAATATCAGCAGG + Intergenic
922118661 1:222640279-222640301 GCCCCAATTAAAATCTCAGAAGG + Intronic
922284867 1:224161945-224161967 ATAACAATTAAAATTCCAGAAGG - Exonic
922381321 1:225030915-225030937 ATCTCAATCAAAATCTCAGTAGG - Intronic
923660905 1:235956470-235956492 ATCCCTATCAAAATCCCAGCAGG + Intergenic
923813890 1:237352546-237352568 ATCTCAATCAAAATCCCAGCAGG + Intronic
923933729 1:238735480-238735502 ATCCCAATCAAAATCACAGCCGG + Intergenic
924305329 1:242682376-242682398 ATCCCAATTATAATCTCAGCTGG + Intergenic
924744963 1:246823187-246823209 ATCCCAATCAAAACCCCAGCAGG - Intergenic
924939074 1:248798613-248798635 GTCCCAATCAAAATCCCAGAAGG - Intergenic
1063253280 10:4297783-4297805 ATCTCAATCAAAATTTCTGCAGG - Intergenic
1063312386 10:4966022-4966044 ATCCGAAGCAAGATTGCAGATGG + Exonic
1063315548 10:5001551-5001573 ATCCGAAGCAAGATTGCAGATGG - Exonic
1063325461 10:5096518-5096540 ATCCGAAGCAAGATTGCAGATGG + Exonic
1063334723 10:5200289-5200311 ATCCGAAGCAAGATTGCAGATGG + Exonic
1063428749 10:5969707-5969729 ATTCCAATCAAAATTTTAGCAGG - Intronic
1063485073 10:6412359-6412381 ATTCCAATAAAAATATCAAAAGG + Intergenic
1063668186 10:8078804-8078826 AGCCCATTAAAAATTCCAGATGG + Intergenic
1063799221 10:9553714-9553736 ATCCCAACCAAAATGACAGAGGG + Intergenic
1063833153 10:9979710-9979732 ATCCAAAACAAAATTTCAGTAGG + Intergenic
1064450651 10:15439366-15439388 ATCCCAAACAAAATCACAGAAGG - Intergenic
1064740281 10:18426153-18426175 ACCCCAAACAAAATGTCAGCAGG - Intronic
1064978912 10:21147000-21147022 TTCCCACTCAAGATTTCTGAAGG + Intronic
1065005372 10:21374716-21374738 ATCTCCATCAAAATCTCAGAAGG + Intergenic
1065097273 10:22293863-22293885 CTTCCAATCAAAATTCCAGCAGG - Intergenic
1065196634 10:23272732-23272754 ATCCTAATCAAAATCCCAGCAGG - Intronic
1065403752 10:25338807-25338829 AATCCAATCAAAATTCCAGCAGG - Intronic
1065412022 10:25439774-25439796 ATACCAATCAAAATTCCAATAGG - Intronic
1065615645 10:27519774-27519796 ATCCCTATCAAAATCCCAGCAGG + Intronic
1065855887 10:29829715-29829737 ATGCCAATCAAAGTTTTAAAAGG - Intergenic
1066492874 10:35911118-35911140 GTGCCAATCAAAACCTCAGATGG - Intergenic
1067016976 10:42764731-42764753 ATTCCAATCAAAATTCTAGCAGG + Intergenic
1067021673 10:42805526-42805548 ATCCCAATCAAAATTGCAGTGGG - Intronic
1067086883 10:43246361-43246383 ATCCCTATCAAAATTCTAGCTGG + Intronic
1067202832 10:44188720-44188742 ATCCCAATCCAAATTCCAGAAGG + Intergenic
1067481166 10:46598513-46598535 ATCCCAATCAAAATCACAACAGG - Intergenic
1067613586 10:47743219-47743241 ATCCCAATCAAAATCACAACAGG + Intergenic
1068089199 10:52411732-52411754 ATCAGAATCAAGATTTCAAATGG - Intergenic
1068775050 10:60859967-60859989 AAGCCAATAAAAAATTCAGATGG + Intergenic
1068893742 10:62176692-62176714 ATCCCAGTCAAAATGACAGCAGG + Intergenic
1069402084 10:68059231-68059253 ATCTCAATGAAAATGTCAAATGG - Intronic
1069851900 10:71411170-71411192 GTCTCAATCAAAATCTCAGCAGG - Intronic
1070246036 10:74731857-74731879 ATCACAATCAAAATTCTAGCTGG + Intergenic
1070445319 10:76493777-76493799 ATCCCAATCAAAATTCTAGCAGG - Intronic
1070446690 10:76511818-76511840 ATTCCTATCAAAATCTCAGCTGG + Intronic
1070468057 10:76744835-76744857 ATCTCAATCAAAATACCAGCAGG - Intergenic
1070673607 10:78396467-78396489 ATTCCAATCAAAAGCTCAGCTGG - Intergenic
1071116425 10:82226444-82226466 ATTCAAATCAAAATCTCACAAGG - Intronic
1071191017 10:83101012-83101034 ATACCAATCAAAATCCCAGCAGG + Intergenic
1071515917 10:86297100-86297122 ATCTCAATCAAAATCTCAAAAGG + Intronic
1071751662 10:88485071-88485093 ATCCCAATCAAAATCCCAGCAGG + Intronic
1072785583 10:98277838-98277860 ATCCCAATGAAAATCCCAGCAGG - Intergenic
1073372661 10:103004863-103004885 ATCCAAATCAAAAATCCAGCAGG - Intronic
1073746969 10:106480188-106480210 AGCCCAATCACCATTTCAGATGG + Intergenic
1074089629 10:110236811-110236833 ATCCCAATAAAAATTCCAGCAGG - Intronic
1074624781 10:115169654-115169676 ATCCCTATCAAAATCTCAGCTGG - Intronic
1074628807 10:115225820-115225842 ATCCCAAACAAAATTTTAGCAGG + Intronic
1074714438 10:116205273-116205295 ATCCCAATAAAAATTTTAAAAGG + Intronic
1074802940 10:117019990-117020012 ATTTCAATCAAAATTCCAGCAGG + Intronic
1075026205 10:118985319-118985341 ATTACAATCAAACTTTCAGCTGG + Intergenic
1075137984 10:119803654-119803676 ATCCCAATCAAAATTCAATCAGG - Intronic
1075186799 10:120268724-120268746 ATCCCAATTAAAATGTCAGTAGG + Intergenic
1075577861 10:123593030-123593052 ATCATAATCAAAATCTCAGCAGG + Intergenic
1075813176 10:125243034-125243056 ATTCCAATCCAAATTCCAGGAGG + Intergenic
1076455991 10:130596439-130596461 ATCCCAAACAAAATCTCATAAGG - Intergenic
1076593161 10:131605164-131605186 ATCCCCATCAAAAGTACACAAGG - Intergenic
1076939763 10:133594892-133594914 ATCCCAACCAAAATTCTAGTAGG - Intergenic
1077041181 11:524084-524106 ATTCCAATCAAAATCCCAGCAGG + Intergenic
1077475280 11:2786521-2786543 TGGCCAATAAAAATTTCAGAAGG - Intronic
1077547061 11:3177317-3177339 ATCCCAATCAAAATTCCAGCAGG + Intergenic
1077955238 11:7012010-7012032 ATTCCAGTCAAATATTCAGATGG + Intronic
1078058369 11:8026798-8026820 ATCCCAATCAAAATTCCAGCAGG - Intronic
1078122621 11:8525208-8525230 ATCCCAATCAAAACTCCAATAGG + Intronic
1078481747 11:11682523-11682545 ATCCCAATCAAAATTGCAGAAGG + Intergenic
1078681179 11:13477952-13477974 ATCCCAATCAAAATTGCAATTGG + Intergenic
1078989026 11:16626583-16626605 ATCCCAATAAAAATCCCAGCAGG - Intronic
1079222930 11:18580012-18580034 ATCCCTATCAAAATCCCAGCTGG + Intronic
1079762231 11:24343433-24343455 ATCCCATTCAATATATCAGCAGG - Intergenic
1079898671 11:26153583-26153605 GTATAAATCAAAATTTCAGATGG + Intergenic
1080598497 11:33798918-33798940 ATCTCTATCAAAATCTCAGATGG + Intergenic
1081404144 11:42676870-42676892 ATCCCCATAAAAATGTCTGAAGG + Intergenic
1081943148 11:46962474-46962496 ATCCCTATCAAAATCCCAGCTGG - Intronic
1082130230 11:48479749-48479771 ATCCCAGTCAAAATTCCAGCAGG - Intergenic
1082193637 11:49276027-49276049 ATCCCAGTCAAAATCCCAGCAGG + Intergenic
1082721784 11:56686738-56686760 ATCCCAATCAAAGTTACAGCAGG + Intergenic
1083291224 11:61691308-61691330 TTTCCAATTACAATTTCAGAGGG - Intronic
1083816994 11:65138784-65138806 ATTCCAATCAAAATCTCAGTAGG + Intergenic
1084351826 11:68607119-68607141 GTCTCAATCCAAATTTCAGTTGG + Intronic
1085131738 11:74045431-74045453 ATCCCTATCAAAATTCCTGCTGG - Intronic
1085712055 11:78838549-78838571 ATGCCAAAATAAATTTCAGACGG - Intronic
1086603832 11:88669873-88669895 ATCTCAATCAATATTCCAGTGGG + Intronic
1086672503 11:89565041-89565063 ATCCCAGTCAAAATCCCAGCAGG - Intergenic
1086806202 11:91246025-91246047 ATCCCAATCACATTTTCACCAGG - Intergenic
1086969892 11:93069475-93069497 ATCTCAATCAAAATTCAAGCAGG + Intergenic
1087673799 11:101135780-101135802 ATCCTAATCAACATTGCAGAAGG - Intergenic
1087986236 11:104684008-104684030 ATCTCAATTAAAATTATAGAAGG - Intergenic
1088121153 11:106371532-106371554 ATTCCAATCAAAATATCAGCAGG - Intergenic
1088518411 11:110664966-110664988 ATTCCAATCAAAATCCCAGTAGG + Intronic
1088583840 11:111341469-111341491 ATCCCAATTATAATTTCAACAGG + Intergenic
1088709534 11:112495531-112495553 ATACCAAAATAAATTTCAGATGG - Intergenic
1089628462 11:119767645-119767667 ATCCCAACCAAAATCCCAGCAGG - Intergenic
1090122275 11:124043055-124043077 ATTCCAATCAAAATCACAGCAGG - Intergenic
1090212374 11:124930625-124930647 ATGCCAATCAAAATCCCAGGAGG + Intronic
1090577827 11:128127528-128127550 ATCCCAATTAAAATCTAAGCAGG + Intergenic
1090633639 11:128672986-128673008 ATCCCAATCACAAGTCCAGTAGG + Intergenic
1090854019 11:130596375-130596397 ACCCCAAATAAAACTTCAGAAGG - Intergenic
1090861777 11:130660309-130660331 AACCCAATCAAAATTCCAGCAGG + Intergenic
1091012533 11:132017688-132017710 ATCCCTATTAAAATCTCAGCAGG - Intronic
1091210912 11:133859273-133859295 ATGCCTATCAAAATTCCAGCAGG - Intergenic
1091257165 11:134199034-134199056 ATCCCTATCAAAATCCAAGATGG + Intronic
1093352193 12:18117324-18117346 ATCCCTATTAAATTTTGAGAAGG - Intronic
1093352304 12:18118613-18118635 ATCCAAATCAAAATTTGAGTAGG - Intronic
1093373680 12:18396876-18396898 ATCCCAATGAAAATCCCAGCAGG + Intronic
1093792856 12:23275240-23275262 ATGTCAATCAAAATCCCAGACGG + Intergenic
1093819651 12:23598213-23598235 CTACCACTCAAAATTTCACATGG + Intronic
1093905491 12:24686938-24686960 ATACAAATCAAAATTTCTGCTGG + Intergenic
1094124515 12:27009293-27009315 ATCCCAATCAAAATCCCAGCAGG - Intronic
1095408647 12:41896952-41896974 ATCCCAATCAAAATTCCAGCAGG + Intergenic
1095681652 12:44983960-44983982 ATCTCAATCAAAATACCAGCAGG - Intergenic
1095904443 12:47363039-47363061 ATTCCAATCAAAATATCAATAGG + Intergenic
1096350798 12:50899173-50899195 ATCACAATCAAAATCCCAGCAGG + Intergenic
1096414111 12:51398595-51398617 AATCCAATTAAGATTTCAGAAGG - Intronic
1097459110 12:59838206-59838228 ATCCCAACAAAAATTCCAGCAGG - Intergenic
1097698753 12:62799662-62799684 ATCCCAATGAAAATACCAGGAGG - Intronic
1098164955 12:67686072-67686094 ATCCCAATAAAAATCTCAAAAGG - Intergenic
1098204063 12:68087691-68087713 ATCCCAATCAAAATCTTGAAAGG - Intergenic
1098382908 12:69887623-69887645 AGCCCAATGAAAATTCTAGAAGG - Intronic
1098546164 12:71714092-71714114 ATCCCTATCAGAATTCCAGTGGG + Intergenic
1098788767 12:74793598-74793620 AGCCTATTCAAACTTTCAGATGG - Intergenic
1098952522 12:76656088-76656110 ATGCCAATTAAAATTAGAGAAGG + Intergenic
1099798397 12:87426450-87426472 ATCCCAATAAAAATGTCACCAGG + Intergenic
1099950777 12:89300637-89300659 ATCCCAATCAAAATTTCATCAGG + Intergenic
1100059411 12:90555006-90555028 ATACCAATCAAAATTCCAGTAGG - Intergenic
1100076198 12:90786816-90786838 ATTACAATCAAAATTCCAGCAGG + Intergenic
1100108792 12:91211252-91211274 ATCCACCTAAAAATTTCAGATGG + Intergenic
1100683398 12:96956347-96956369 ATCCCAATAAGAATTTTAGTAGG + Intergenic
1100894588 12:99166711-99166733 ATCCTAATCAAAATCCCAGCAGG + Intronic
1100905725 12:99296356-99296378 AACCCAATCAAAATCCCAGCAGG - Intronic
1102088857 12:110169330-110169352 ATACCAAGCAAAATCGCAGAGGG - Intronic
1103220986 12:119245044-119245066 ATCCCAATCAAAATCCCAGTTGG - Intergenic
1104529094 12:129551897-129551919 ACCCCAACCAAAATATCAGAGGG - Intronic
1105030532 12:132880023-132880045 ATTCCAGTCAAAATCCCAGAGGG + Intronic
1105035158 12:132914246-132914268 ATCCCAATGGAAATTCCAGCAGG - Intronic
1105643381 13:22289410-22289432 ATCCCTATCAAAATCCCAGCAGG - Intergenic
1105692657 13:22857681-22857703 ATCCCAGTGAAAATCTCAGTAGG - Intergenic
1105698355 13:22913385-22913407 ATATCAATCAAAATTCCAGAAGG + Intergenic
1105850012 13:24325629-24325651 ATCTCAATCAAAATTCCAGAAGG + Intergenic
1105936453 13:25104741-25104763 ATCCCAAATAAAATCTCAGCAGG + Intergenic
1106622754 13:31387002-31387024 ATCCTACTCAAAATTCCAGCTGG - Intergenic
1106775003 13:33000186-33000208 ATCACAAACAAGGTTTCAGAGGG + Intergenic
1106867600 13:33984399-33984421 ATCCCAATCAAAATTTAATAGGG + Intergenic
1107438939 13:40406843-40406865 ATACCAATAAAAAGTTGAGATGG - Intergenic
1107496110 13:40927504-40927526 ATCCCAATCAAAATCCCAAGTGG + Intergenic
1107537237 13:41347393-41347415 ATCCCTATCAAAATCCCAGATGG - Intronic
1107763419 13:43707350-43707372 ATCCCAATGAAAATCACAGCAGG + Intronic
1107777961 13:43866475-43866497 GTCCCAGTCAAAATTTCAGCAGG - Intronic
1108120857 13:47184554-47184576 ATCCCAAGGAAACTTTCATATGG - Intergenic
1108342168 13:49508003-49508025 ATTCCAATCAAAATTCCAAAAGG - Intronic
1108342735 13:49513977-49513999 AACCTAATGAAACTTTCAGAAGG - Intronic
1108560554 13:51639434-51639456 ATTCCAAGCAAAATTGTAGAGGG + Intronic
1108583809 13:51850129-51850151 ATCTCAAACAAAATTACAGAAGG - Intergenic
1108789488 13:53950301-53950323 ATCCCTATCAAGATCTCAGTTGG - Intergenic
1108998058 13:56760337-56760359 ATGGCAATAGAAATTTCAGAGGG - Intergenic
1109083300 13:57935766-57935788 ATCCCACTGAAAATTTCAGCAGG - Intergenic
1109240904 13:59886502-59886524 TTCCCAATCAAAATCTCAGCAGG - Intronic
1109809447 13:67492721-67492743 ATCCCAATCAAAATTCTATTAGG + Intergenic
1109904985 13:68829128-68829150 ATCTCAATCAAAATCCCAGCAGG + Intergenic
1110636391 13:77771282-77771304 ATCCCAATCAAAATTCCAATAGG - Intergenic
1110654641 13:77983112-77983134 CTCCCAACCAAAATTCCAGAAGG - Intergenic
1111041169 13:82750300-82750322 AATTTAATCAAAATTTCAGAAGG + Intergenic
1111231051 13:85344456-85344478 ATCCTAAGCAGAATTTCAGGTGG - Intergenic
1111314168 13:86530455-86530477 ATCCAAATCAAAATTCCATCAGG - Intergenic
1111377184 13:87396135-87396157 ATCCCAAGCAGAATTTAAAAGGG + Intergenic
1112148246 13:96726268-96726290 ATTCCAATCAAAATCCCAGCAGG - Intronic
1112153289 13:96788275-96788297 ATACCAATCAAAATCTCAGGAGG - Intronic
1112181615 13:97088027-97088049 ATACCAATCAACATATCAGCAGG + Intergenic
1112217817 13:97452681-97452703 ATCCCAATCAAAATGCCAGAAGG - Intronic
1112256415 13:97836423-97836445 ATACCAATCAAAATCTCAGCAGG - Intergenic
1112524763 13:100134431-100134453 ATTCTAATCAAAATCTCAGCAGG - Intronic
1113476475 13:110585568-110585590 ATTCCAATCAAAATCTCAACAGG - Intergenic
1113603609 13:111588909-111588931 ACCGCAATAAAAATTTCAGAAGG + Intronic
1113924490 13:113933540-113933562 ATCCCAATCAGAATCCCAGCAGG - Intergenic
1113946319 13:114046028-114046050 ATCCCAGTCAAAATTCCTGTGGG + Intronic
1114697182 14:24637331-24637353 ATCTCTGTCAAAATTTCAAATGG - Intergenic
1114719604 14:24866858-24866880 ATCTCAATCAAAATTCCAGTGGG + Intronic
1114846940 14:26333592-26333614 ATTCCTATCAAAATTCCAGAAGG - Intergenic
1115561726 14:34588768-34588790 ATCCCAATCAAAATCCCAGCAGG + Intronic
1115854275 14:37612533-37612555 ATCCCAATAAAAAATACAGCAGG - Intronic
1116539461 14:46081230-46081252 ATCTCACTCAAAATTTCAGGAGG - Intergenic
1116593050 14:46804875-46804897 ATTACAATCAAAATTTTAGGGGG - Intergenic
1116665152 14:47765241-47765263 ATACCAATTAAAATCTCAGCAGG + Intergenic
1116749108 14:48860109-48860131 ATCTCAATCCAAATCTCAGTGGG + Intergenic
1116877675 14:50129342-50129364 ATGCCAAGCAATATTTTAGATGG + Intronic
1116911963 14:50477024-50477046 ACCCCAATCACAATTTGAGGAGG - Intronic
1116974643 14:51101877-51101899 CTTCCAGTAAAAATTTCAGAAGG + Intergenic
1117068819 14:52037687-52037709 ATCCCTATCAGAATCTCAGCTGG - Intronic
1117228564 14:53690368-53690390 ATCCCAATCAAAGTCTCAGTAGG - Intergenic
1117471330 14:56048965-56048987 GTCCCAATGAAAATTCCAGCTGG + Intergenic
1117698299 14:58388579-58388601 ATCCCAATAAAAATACCAGCAGG + Intergenic
1117723993 14:58654593-58654615 ATACCAATAAAAATTTTAGCAGG - Intergenic
1118192433 14:63592769-63592791 ATCCCAATAAAAATTCCAGTTGG - Intergenic
1118230875 14:63948200-63948222 ATCCTAATAAAAATTCCAGCAGG - Intronic
1119179997 14:72599168-72599190 TTCCCCAACAAAATTTTAGATGG + Intergenic
1119587905 14:75855220-75855242 ATCACAATAAAAATTCCAGCAGG - Intronic
1119637054 14:76282170-76282192 ATCCCAATGAAAACATCAGTAGG + Intergenic
1120419002 14:84258759-84258781 ATTCCACTCAGAGTTTCAGAGGG - Intergenic
1120688455 14:87565535-87565557 ATCCCAAACCAATTTTCAAAGGG + Intergenic
1121209190 14:92194472-92194494 ATCTCAATCAAAATCTCAGCAGG + Intergenic
1121375787 14:93409819-93409841 ATTCCAGTCAAAATTTCAAAAGG + Intronic
1121468430 14:94131133-94131155 GTACCAATCTAAATTCCAGACGG - Intergenic
1121468689 14:94134710-94134732 ATCCCAATAGAAATTCCAGCAGG + Intergenic
1121785002 14:96651160-96651182 ATCCCTATCAAGATCTCAGTAGG - Intergenic
1122305110 14:100760226-100760248 ATCCCTATCAAAATCCCAGAAGG + Intergenic
1122385815 14:101346775-101346797 ATCCCAATCAAAATTTCTATAGG + Intergenic
1122839964 14:104453626-104453648 ATCTCAATCAAAATTCCAGAAGG + Intergenic
1122851884 14:104538189-104538211 ATCCCAATCAAAATCCCATTAGG - Intronic
1123715691 15:23029189-23029211 ATCCCAATAAAAACTCCAGCTGG + Intronic
1124361703 15:29041715-29041737 ATCCCAATCAAATTTCCAGCAGG + Intronic
1124394299 15:29287710-29287732 ATCCCATTAAAAATTCCAGCAGG + Intronic
1124547019 15:30638172-30638194 TTACCAATTAAAATTTCTGAAGG - Intronic
1124578719 15:30932244-30932266 ATTCCAATTAAAATCTCAGCTGG - Intronic
1124586006 15:31007720-31007742 ATACCAATCAAAATCCCAGCAGG - Intronic
1124675610 15:31682341-31682363 ATCCCAGTCAACATTCCAGCAGG + Intronic
1124683801 15:31760657-31760679 ATCCCTTTCAAAATTCCAGCTGG + Intronic
1124780620 15:32628161-32628183 TTACCAATTAAAATTTCTGAAGG - Intronic
1125013076 15:34901415-34901437 ATATCAAATAAAATTTCAGAAGG + Intronic
1125121677 15:36166757-36166779 ATCCCAATTAAAATCACAGCAGG - Intergenic
1125166999 15:36718394-36718416 ATCCCAATCTAAATCGCAGCAGG - Intronic
1125290729 15:38143157-38143179 ATCTCAATCAAAATCTCAGCAGG + Intergenic
1125495753 15:40192031-40192053 ATCACTATCAAAATTCCAGCTGG - Intronic
1126248871 15:46542713-46542735 ATCCCAATGAAAATCCCAGCAGG - Intergenic
1126463013 15:48933526-48933548 ATCCCTATCAAAATCTCAGATGG + Intronic
1126987995 15:54336951-54336973 ATCTCAATTAAAATCCCAGAAGG - Intronic
1127191244 15:56532885-56532907 ATCCAATTCAAAACTTCAGAGGG - Intergenic
1127276230 15:57447054-57447076 ATCCCAATCAAAATTCCTAGAGG - Intronic
1127731273 15:61804266-61804288 ATCCCCATCAAAATCCCAGTAGG + Intergenic
1127846109 15:62872893-62872915 ATCCTTATCAGAATTTGAGAGGG + Intergenic
1128316829 15:66665452-66665474 ATCCCAATCAAAATCTCAGCAGG - Intronic
1129058642 15:72841723-72841745 ATCCCAATGAAAATTCCAGCAGG - Intergenic
1129093336 15:73175514-73175536 ATCCCAATCAAAATCCCAGCAGG + Intronic
1129547532 15:76412778-76412800 ATCCTAATCAAAATCCCAGCAGG - Intronic
1129629815 15:77246307-77246329 ATCCCTATCAAAAGTCCAGCAGG - Intronic
1130121971 15:81058164-81058186 ATCTCCATCAAAATCTCAGATGG - Intronic
1130211280 15:81925139-81925161 ATCCCAATCAATAGTTCAGAAGG + Intergenic
1130560883 15:84957856-84957878 ATCTCTATCAAAATCTCAGCTGG - Intergenic
1130977198 15:88785773-88785795 ATCCCAATCAAAATCTCAGAAGG + Intergenic
1131673196 15:94643862-94643884 ATTCCAATCAATATATCAGTAGG + Intergenic
1132134786 15:99324973-99324995 ATCCCTATCAAAATCCCAGGAGG - Intronic
1132388395 15:101419513-101419535 ATCCCAATCAAAATCCCAACAGG + Intronic
1134200477 16:12194029-12194051 AGCCCAATCAAAATCCCAGCAGG - Intronic
1134438164 16:14280906-14280928 TTCCCAATCAAAATCCCAGAAGG + Intergenic
1134793867 16:17016377-17016399 ATCTCAATCAAAATCCCAGCAGG - Intergenic
1134899435 16:17923222-17923244 ATTCCTATCAAAATTCCAGCAGG + Intergenic
1135421556 16:22308729-22308751 ATTCCAACAAAAATGTCAGAAGG - Intronic
1135697070 16:24597623-24597645 ATCCCAGTCAAAATCCCAGCTGG - Intergenic
1135795556 16:25438393-25438415 ATCCCATTCAAAATCCCAGCAGG - Intergenic
1136650609 16:31666649-31666671 AGTTCAATCAAAATTTGAGAAGG + Intergenic
1137445499 16:48529391-48529413 ATCCCAATAAAAATTCCAGCAGG - Intergenic
1137520137 16:49186416-49186438 ATCCCAAACAAAATTCCAACAGG - Intergenic
1137908152 16:52347291-52347313 ATCCCTACCAAAATCTCAGATGG + Intergenic
1138157169 16:54716516-54716538 ATTCAAATCAAAATTTTAGAAGG + Intergenic
1138171959 16:54859928-54859950 ATCCCAATCCAAATTCCAGGAGG + Intergenic
1138426418 16:56935855-56935877 ATCACAATGAAAATTTCCAAAGG - Intronic
1138690405 16:58762528-58762550 ATCCCAATCAAAACCCCAGCAGG - Intergenic
1140007130 16:71089482-71089504 ATCTCAAAGAAACTTTCAGAAGG + Intronic
1140324876 16:73991776-73991798 ATCCATATCAAAATCTCAGCTGG + Intergenic
1141008120 16:80372231-80372253 ATTCCAATTTAATTTTCAGAAGG - Intergenic
1141061903 16:80881162-80881184 ATTCCAGTCAAAATATCAGCAGG + Intergenic
1141946394 16:87313122-87313144 GTCCCAATCAAAATTCCAGTAGG + Intronic
1142512439 17:405246-405268 ATCCCCATCAAAATCTCAAAGGG + Intergenic
1143040310 17:4030511-4030533 ATGCCAATCAAAATCCCAGAAGG + Intronic
1143311443 17:5993589-5993611 ATTACAGTCAAAATTTCAGGAGG - Intronic
1143424882 17:6827633-6827655 ATGCCAATGAAAATCTCAGCAGG - Intronic
1143531253 17:7505108-7505130 ATCCCTATCAAAATTCCAACTGG + Intronic
1143969214 17:10781422-10781444 ATTCCAATAAAAATCTCAGCAGG - Intergenic
1144116744 17:12101568-12101590 ATCCCAATAAAAATTTCAGCAGG - Intronic
1144313030 17:14031005-14031027 ATTTCAATAAAAATTTCAGTAGG + Intergenic
1145387331 17:22424725-22424747 ATCCGAATCAAAATCCCAGCAGG - Intergenic
1146479166 17:33190486-33190508 AACCCAATGAAAATCTCAGCAGG + Intronic
1146840236 17:36147294-36147316 ATCTCAGTCAAAATCTTAGAAGG - Intergenic
1147031224 17:37638685-37638707 ATACCAAATAAAATTTCACAGGG + Intronic
1147174179 17:38642429-38642451 ATCACAATCAAAATGTCAGCAGG + Intergenic
1149195852 17:54119798-54119820 ATTCCAATCAAAATTGCAACTGG - Intergenic
1149953227 17:61015087-61015109 ATCCCTATCAAAAACTCAGCTGG + Intronic
1150167026 17:62953702-62953724 ATTCCAATCAAAATTACAATAGG - Intergenic
1150233785 17:63575806-63575828 ATCCCAATCAGAATCTCAGCAGG + Intronic
1150480990 17:65510480-65510502 GTCCCAATCAAAATCCCAGAGGG + Intergenic
1152050717 17:77973934-77973956 ATCTCTATCAAAATCCCAGAAGG + Intergenic
1152213628 17:79019017-79019039 ATTCCATTCAAAATCCCAGAAGG - Intergenic
1152254829 17:79232226-79232248 ATCCCGATCAAAATCCCAGCAGG + Intronic
1152384123 17:79959348-79959370 AGCCCAATCAAAATTCCAACAGG + Intronic
1152513930 17:80810672-80810694 ATTCCAGTCAAAATCTCAGCAGG - Intronic
1152593506 17:81225603-81225625 ATCCCCATCAAAATCACAGCTGG - Intergenic
1153126206 18:1794127-1794149 ATCCTAATCAAGATTTCAGTTGG - Intergenic
1153395267 18:4612908-4612930 ACACCAAACAAAATTTGAGAAGG - Intergenic
1153628702 18:7047538-7047560 ATCCCAATGAAAATCTTAGCAGG + Intronic
1153639723 18:7146399-7146421 ATCCCAAAAAAAATGTAAGAGGG - Intergenic
1153825743 18:8872950-8872972 ATCTCCATCAAAATTCCAGCTGG - Intergenic
1154139847 18:11813376-11813398 ATCCCAATCAAAATACCAACAGG + Intronic
1154504210 18:15019671-15019693 ATCCCTGTCAAAATCTCAGATGG - Intergenic
1154972737 18:21427075-21427097 AGCCCCATCAAAATTCCAGCTGG - Intronic
1155380182 18:25212590-25212612 ATTCCAATGAAAATTTCAACAGG - Intronic
1155446484 18:25918191-25918213 ATCCCAGTCAAAATATCACTGGG + Intergenic
1156259746 18:35434270-35434292 ATCCCTATCAAAATCTCAGTGGG - Intergenic
1156262206 18:35455840-35455862 ATTCCAATCAAAATTGTAGTAGG + Intronic
1156581210 18:38378170-38378192 ATCCCAATAAAACTATCAGTGGG + Intergenic
1156597241 18:38561523-38561545 ATTCCAAACAGAATTTCAAATGG + Intergenic
1156832490 18:41510714-41510736 ATCCCAATCAAAATCCCAGCAGG + Intergenic
1157756205 18:50219860-50219882 AAGGCAATCAAAATATCAGAAGG + Intergenic
1158261889 18:55615122-55615144 GTCCCAATGAAAATCTTAGAAGG - Intronic
1158270242 18:55705331-55705353 ATTCCAATCAGAATTCCAGCAGG - Intergenic
1159104606 18:63991254-63991276 GTCCTAATCAAAATTGCAGCAGG - Intronic
1159304354 18:66620415-66620437 ATCCCTATTAAAATATCAGATGG - Intergenic
1159713155 18:71788915-71788937 CTGCCAATTAAAATTTCAGTAGG + Intergenic
1159885066 18:73896010-73896032 TTCGCATTCCAAATTTCAGAGGG + Intergenic
1160132716 18:76243109-76243131 ATTCCTATCAAAATCTCAGCAGG + Intergenic
1160368833 18:78353448-78353470 ATTCCAATCAAAACTCCAGCAGG - Intergenic
1160471251 18:79136204-79136226 ATCCCATTCAAAACTGCAGAAGG - Intronic
1161178434 19:2862889-2862911 CTCCCAATCTAAATTTCAGTGGG + Intergenic
1162250660 19:9440496-9440518 ATCCCTATCAAAATTCCAGATGG - Intergenic
1163193735 19:15698804-15698826 GTCCCAGTAAAAATTTAAGAAGG - Intergenic
1163375837 19:16929896-16929918 ATCCCAGTCAAAATCCCAGGAGG + Intronic
1164815531 19:31198878-31198900 ATCCTAATCAAAATCCCAGAAGG + Intergenic
1164819379 19:31233953-31233975 ATTCCAAACAAAATCTCAGCAGG - Intergenic
1164900138 19:31912093-31912115 ATCCAAATGAAAATATCAGTGGG - Intergenic
1164999916 19:32752481-32752503 ATTCCAATTAAAAATGCAGAAGG - Intronic
1165375953 19:35442083-35442105 AGCCCATTCAAAATTCCAGCAGG + Intergenic
1165588002 19:36938067-36938089 ATCCCAATAAAAATTCCAACAGG - Intronic
1166050932 19:40258855-40258877 ATCCCTATCAAAATTCCAACAGG + Intronic
1166066885 19:40365321-40365343 ATCCCTACCAAAATATCAGCTGG + Intronic
1166146162 19:40837357-40837379 ATCCCAATAAAAATTTCAGCAGG + Intronic
1166150259 19:40868297-40868319 ATCTCAATCAAAATTTCAGCAGG + Intronic
1166585274 19:43940873-43940895 GTCCCGATTAAAATTTCAGCAGG - Intergenic
1167169092 19:47819306-47819328 ATCCCAATCAGAATCTCATCAGG - Intergenic
926100760 2:10115632-10115654 AACCCAACCAATATTTGAGAGGG + Intergenic
926237885 2:11061669-11061691 ATCACAATCTAAATTTTAGTAGG - Intergenic
926612732 2:14962608-14962630 ATCCCTTTCAAGAATTCAGATGG + Intergenic
926846220 2:17143363-17143385 ATCCTAATCAAAATCTCAGTTGG + Intergenic
927061092 2:19420671-19420693 ATCCCAGACAAAATATCAGTAGG - Intergenic
927262488 2:21106340-21106362 ATCCCAATCAAAATCACAATCGG - Intergenic
927297649 2:21473199-21473221 ATTTCAATCAAAATTCCAAAAGG + Intergenic
927446898 2:23170850-23170872 ATCCCAATGAAAATTGCAGCAGG + Intergenic
927747618 2:25635607-25635629 ATCCCAATCAAAATCTCTGCAGG + Intronic
928049489 2:27975204-27975226 ATCCCCATCAAAATCCCAGCAGG + Intronic
928665039 2:33542468-33542490 ATTCCAATCAAAATCCCAGTAGG - Intronic
928807331 2:35175651-35175673 ATCCCAATTAAAATTCTAGTAGG - Intergenic
929376087 2:41288772-41288794 ATGCAAGTCAAAAATTCAGAGGG + Intergenic
929463205 2:42120863-42120885 ATCCTCATCAAAATTCCAGTAGG - Intergenic
929616147 2:43310165-43310187 ATCCCTATCAAGATTCCAGCTGG + Intronic
929715817 2:44308381-44308403 ATCCCTATCAAAATCCCAGTTGG - Intronic
929801350 2:45106334-45106356 ATCCCTATCAAAATTCCAGATGG + Intergenic
929991511 2:46793288-46793310 ATCCCAATCAAAATCCTAGCAGG + Intergenic
930443252 2:51436363-51436385 ATCCTAATCAAAATCTCAGCAGG + Intergenic
930555587 2:52891795-52891817 AATACAATCAAAATTTAAGAAGG - Intergenic
930733873 2:54755397-54755419 ATCTCAATCAAAATATCAGCAGG - Intronic
931330180 2:61272650-61272672 ATCTGAATTAACATTTCAGAGGG - Intronic
932305670 2:70702094-70702116 ATCCCAATCAAAATCCCAAAAGG + Intronic
932532642 2:72553399-72553421 ATTCAAATCAAAATTCTAGAAGG + Intronic
932630319 2:73336439-73336461 ATCCCTATCAAAATCTCAGCTGG - Intergenic
932994250 2:76829693-76829715 ATCCCAAAGAAAATTGAAGAGGG - Intronic
933056144 2:77668398-77668420 ATCCCAATCAAAATCTAAGCTGG + Intergenic
933122480 2:78557775-78557797 ACCTCATTCCAAATTTCAGAGGG - Intergenic
933883297 2:86693646-86693668 ATCCCAATTAAAATCTCAATAGG + Intronic
933927642 2:87112381-87112403 ATCCCAATCAAAATCTAAGCTGG + Intergenic
933985392 2:87586973-87586995 ATCTTGATCAAAATTTCATAAGG - Intergenic
934569970 2:95363624-95363646 ATTCCAATAAAAAATTCAGTTGG - Intronic
934920326 2:98338845-98338867 ATCCCAATTAAAATTCCAACAGG - Intronic
935037079 2:99387687-99387709 ATCCCAATCAAAATCCTAAAAGG - Intronic
935343892 2:102085744-102085766 ATCCCAATCAAAATCGCTGTTGG - Intronic
935613510 2:105051577-105051599 ATCCCTATCAAAATCTTAGGTGG - Intronic
935670268 2:105549798-105549820 ATCCTAATCAACATCTCAGCAGG - Intergenic
935831495 2:107005493-107005515 ATCCCCAGGAAACTTTCAGAAGG - Intergenic
936308449 2:111363836-111363858 ATCTTGATCAAAATTTCATAAGG + Intergenic
936906841 2:117546217-117546239 ATTCCAGTAAAAATTTCAAAAGG - Intergenic
937931362 2:127207928-127207950 ATCCCTATCATAATTCCAGTGGG + Intronic
937954410 2:127412957-127412979 ATCCAAATCAAGATTTCACCAGG + Intergenic
937961245 2:127461178-127461200 ATCCCTATCAAAATCCCAGTTGG + Intronic
938403575 2:131014454-131014476 ATTCCTATCAAAATTCCAGCAGG - Intronic
938404063 2:131017891-131017913 ATTCCTATCAAAATCTCAGCAGG + Intronic
939424720 2:142020104-142020126 ATCCCCATCAAAATTGCAAAAGG + Intronic
939483596 2:142779889-142779911 ATCCCAATCAAAATTTTCGTAGG + Intergenic
939487431 2:142832541-142832563 ATCCCAATCAAAATCCTAGCAGG + Intergenic
939593114 2:144090795-144090817 ATCCCATTCAAAATCTCAGAGGG + Intronic
939695612 2:145319970-145319992 ACGCCAATCAAAATTTCAGCAGG + Intergenic
939808535 2:146804545-146804567 ACCCCAATCAAAATTCCAATCGG - Intergenic
940203180 2:151173909-151173931 ACCCCAATCATTATTTCAGAAGG + Intergenic
940411687 2:153371751-153371773 ATCCCAATCAAAATTCTAGCTGG + Intergenic
940524678 2:154798369-154798391 ATCTCAATCAAAATCTCAACAGG + Intronic
940741436 2:157513771-157513793 ATCCCAATAAAAATCTCTCAGGG + Intergenic
940774447 2:157872234-157872256 ATTCCAATTAAAATTTCTGATGG + Intronic
940852041 2:158697161-158697183 GCCCCAATCAAAATCTCAGCAGG + Intergenic
941051987 2:160745429-160745451 ATCACAATAAAAATTCCAGCAGG + Intergenic
941305808 2:163865040-163865062 ATTGCAATCAAAATTTCAGAAGG - Intergenic
941398310 2:164998815-164998837 AAACCAATAAAAATTCCAGAAGG - Intergenic
941438500 2:165503241-165503263 ATGCCAATAAAATTTTCAAATGG - Intronic
941552346 2:166933111-166933133 ATTCCAATTAAAATTCCAGAAGG - Intronic
941552407 2:166933611-166933633 ATTCCAATTAAAATTCCAGAAGG + Intronic
941802731 2:169678478-169678500 ATCCCAATAAAAATTCCAGCTGG + Intronic
941944818 2:171084074-171084096 ATCCCCCTCAAAACATCAGATGG + Intronic
942405052 2:175645276-175645298 ATCCCAATCAAAATCCCAGCAGG - Intergenic
942583735 2:177450789-177450811 ATCCCAATCAAAATCCCAATGGG - Intronic
942804408 2:179912751-179912773 AACCCATTCAAACCTTCAGATGG + Intergenic
943086611 2:183319321-183319343 ATACCTATCATAATTTTAGAGGG + Intergenic
943277609 2:185888041-185888063 ATTCCAATCAAAATCTCAGTGGG + Intergenic
943306557 2:186269784-186269806 AGCCCAGTCAATCTTTCAGATGG + Intergenic
943464684 2:188214604-188214626 ATCCCAACCAAAATTCTAGCAGG - Intergenic
943821125 2:192322448-192322470 ATTCCAATCAAAATGTCAGAAGG + Intergenic
945052783 2:205841229-205841251 ATCCCTAGCAAAATTTCAGCTGG + Intergenic
945305168 2:208253465-208253487 AACCCAATCCCAACTTCAGAAGG + Intronic
945530184 2:210943980-210944002 ATCCCACTGAAAATGTCAGAAGG - Intergenic
945531749 2:210963663-210963685 ATTTCAATCAAAATTTCAATAGG - Intergenic
945871560 2:215232179-215232201 ATCTCAAACACAATTTCAGGTGG - Intergenic
945964610 2:216172791-216172813 ATCCCTATCAAAATACCAGTGGG - Intronic
946212594 2:218159368-218159390 ATCCAAATCAAAATCCCAGCTGG + Intergenic
946650075 2:221883876-221883898 ATCTTAATAAAAATGTCAGAGGG - Intergenic
946727876 2:222679437-222679459 ATCCCAATCAAAATCCCAGGAGG - Intronic
947466213 2:230349404-230349426 ATTCCTATCAAAATTCCAAATGG - Intronic
947895648 2:233669356-233669378 ACCCCAATCTAAATTCCAGCAGG - Intronic
947896355 2:233677085-233677107 ATCCCAATCAAAATCCTAGCAGG - Intronic
947969271 2:234308441-234308463 AACTCAAACAAAATTACAGAAGG - Intergenic
1168999542 20:2157712-2157734 ATCCCCACCAAAATCTCAGCAGG + Intronic
1170100852 20:12697779-12697801 ATCCCATAGAAAATTTCCGATGG - Intergenic
1170410912 20:16090417-16090439 ATCCCTATCAAAATCACAGCAGG + Intergenic
1170865858 20:20156928-20156950 ATCCCAATCACATTTTCAGCAGG + Intronic
1170931879 20:20775927-20775949 TTCCCTATCAAAATTCCAGCTGG - Intergenic
1172051199 20:32120181-32120203 ATCCTTATCAAAATTCCAGCAGG - Intronic
1172346274 20:34203166-34203188 ATCCCAATAAAAATTCCAGCAGG - Intronic
1172454810 20:35061433-35061455 ATCACTATCAAAATCTCAGCTGG + Intronic
1172857739 20:38019972-38019994 ATCCTAATCAAAATCCCAGTAGG + Intronic
1173121758 20:40298094-40298116 ATCCCAATCAAAATTCTGGCAGG + Intergenic
1174846275 20:53946201-53946223 ATCCAAATCAACATGTCACATGG + Intronic
1174957187 20:55111432-55111454 ATTCCAATCAAAATTTGAGCAGG - Intergenic
1175742948 20:61433520-61433542 ATCCCAGTCAAAATTCTAGCAGG - Intronic
1176193309 20:63824576-63824598 ATCCCACCCAAAATTTCACGTGG + Intronic
1176274869 20:64259269-64259291 ATCCAAATCAACAGGTCAGATGG + Intronic
1177621256 21:23597655-23597677 ATCCCAATCAAAATCCCAGGAGG + Intergenic
1177993019 21:28060265-28060287 ATCCCTGTCAAAACCTCAGATGG + Intergenic
1178568252 21:33709161-33709183 ATCCCAATCAAAATTGCAGCAGG - Intronic
1178831133 21:36057586-36057608 ATCCTAATCAAAATTCAAGCAGG + Intronic
1178941077 21:36906654-36906676 ATCCCAGTCAAAATCCCAGAAGG + Intronic
1179009362 21:37543943-37543965 ATCCCAATCAAAATTCCAGGAGG + Intergenic
1179087515 21:38230958-38230980 ATACCTATCAAAATTCCAAATGG - Intronic
1179155366 21:38845881-38845903 ATCCCAATCCAAATCCCAGATGG - Intergenic
1179204730 21:39264911-39264933 ATCCAAAACCAAATATCAGAAGG + Exonic
1179448169 21:41448159-41448181 AGCCCCATCAGAAGTTCAGAGGG - Intronic
1179768121 21:43589459-43589481 ATCCCAATAAAAATTCCAACAGG + Intronic
1179970403 21:44833899-44833921 ACCCCAACCAAAATCTCAGCAGG + Intergenic
1180029355 21:45193929-45193951 ATCCTAATCAAAATCTCAACAGG + Intronic
1180124485 21:45779804-45779826 CTCCCAATCAAAGTCCCAGAAGG + Intronic
1182054739 22:27342066-27342088 ATCCCAATCAAAATCCCAGCAGG - Intergenic
1182139924 22:27945076-27945098 ATCCCACTCAAAAGTCCAGCAGG - Intergenic
1184328627 22:43811554-43811576 CTTCCAAACAAAATTTCTGAGGG + Intronic
1184392075 22:44208688-44208710 ATTCCAGTCAAAATTTCAGCAGG - Intronic
1184448203 22:44566260-44566282 ATCCCAATTAAAATCCCAGCAGG + Intergenic
1184484690 22:44769494-44769516 ATCCCAATCAAAATCCCAGCAGG - Intronic
1185307917 22:50132340-50132362 ATCCCAATCAAAATCCCAACAGG - Intronic
1185361479 22:50410174-50410196 AACCTCATCAAAATTTCAGTAGG - Intronic
949632671 3:5945423-5945445 ATCCTAATCAAAATTGTAGCAGG - Intergenic
949898312 3:8787717-8787739 ATCTCTATCAAAATTCCAGCTGG - Intronic
950299047 3:11858611-11858633 ATTCCAGTAAAAATCTCAGAGGG - Intergenic
950825749 3:15818848-15818870 ATCACAGTCAAAATCTCAGTGGG + Intronic
950914241 3:16627651-16627673 ATCCCAAGCCAAATCACAGATGG - Intronic
951406166 3:22300819-22300841 ATTCCCATCAAAATTGCACATGG - Intronic
951910248 3:27742879-27742901 ATTCCAATCAAAATCCCAGCAGG - Intergenic
952033270 3:29170402-29170424 ATCCCAATGACAATCTTAGAAGG + Intergenic
952191949 3:31032695-31032717 ATCCTAATCAAAATCCCAGAAGG - Intergenic
952561624 3:34601526-34601548 ATCCCTTTAAAAATTTCAGCAGG + Intergenic
952566536 3:34665910-34665932 ATTCCATTCAAAATTACACAGGG - Intergenic
952775597 3:37043111-37043133 ATCCCAATCAAAATCTCAGCAGG - Intronic
953137500 3:40194610-40194632 ATTCCAATCAAAACTTAAAAAGG - Intronic
953172588 3:40521181-40521203 ATCCCAATCAAACTCCCAGGAGG - Intergenic
953780112 3:45861241-45861263 TTCCAGATCAAAACTTCAGAGGG + Intronic
954253407 3:49386114-49386136 ATTCCTATCAAAATTCCAGCTGG - Intronic
954530783 3:51318048-51318070 ATCCCAGTCAAAATCTCAGCAGG - Intronic
954842959 3:53528573-53528595 ATCTCAATCAAAACCCCAGAAGG - Intronic
954851860 3:53608040-53608062 ATCCCAATCAAAATCTAAACAGG - Intronic
954893070 3:53949463-53949485 ATCCCTATCAAAATTCCGGCGGG + Intergenic
955048507 3:55385356-55385378 ATCCCAATCTAAATCCCAGTGGG + Intergenic
955283970 3:57620925-57620947 ATCCCACTCAAAATCCCAGCAGG + Intergenic
955886502 3:63604816-63604838 TTCCCAAACAAAACTTCACATGG - Intronic
956563201 3:70605708-70605730 ACCCCAATGAAAATTGCAAAGGG - Intergenic
956988987 3:74741048-74741070 ATCCCAATCAAATTCACAGTAGG - Intergenic
957266998 3:77980217-77980239 TTCCCAATCAAAATCCCAGTGGG + Intergenic
958154355 3:89734800-89734822 ATTCTAATCCAAATTTCATACGG - Intergenic
958449027 3:94250385-94250407 ATACTAATCAGAATTTCATAGGG + Intergenic
958576395 3:95954100-95954122 ATCCCAATCAAAATCCCAGAAGG + Intergenic
958628005 3:96651016-96651038 ATCTCAATCAAAATCCCAGGAGG - Intergenic
959332770 3:105026793-105026815 ATCCCAATTAACATGTCAGCAGG + Intergenic
959428800 3:106225729-106225751 ATCCCATTCAAAATCCCAGCAGG - Intergenic
959479314 3:106852767-106852789 ATCCCAATCAAAATTACCATAGG + Intergenic
959951756 3:112186556-112186578 ATCTCAATGGAAATTTCAGTAGG + Intronic
960755028 3:121001791-121001813 ACCCCAATGAAATCTTCAGAAGG - Intronic
960813590 3:121650271-121650293 ATCCCAATCAAAATCTGAACAGG + Intronic
960894225 3:122484804-122484826 ATCCCAATCAAATTCCCAGCAGG + Intronic
961591187 3:127982971-127982993 ATCCCAAACACAAGCTCAGAGGG + Intronic
962286412 3:134089293-134089315 ACGCCAATCAAAATTCCAGCTGG + Intronic
962824060 3:139082870-139082892 ATCCCAATCAAAATCCCAGCAGG - Intronic
963035473 3:141022086-141022108 ATCCTAATCAATATTCCAGGAGG - Intergenic
963736722 3:149025733-149025755 ATCCTTATGAAAATTTGAGATGG + Intronic
964002435 3:151791540-151791562 ATCCCAATCTAGATCCCAGAAGG + Intergenic
964256852 3:154784497-154784519 ATCCCAATAAAAATTCCAATAGG - Intergenic
964738938 3:159945041-159945063 ACCCAACTGAAAATTTCAGAAGG - Intergenic
964942740 3:162179545-162179567 ATCTCAATCACAATTTCAGCTGG - Intergenic
965007996 3:163050639-163050661 ATCCAAATGAAAATTTAGGAAGG - Intergenic
965538074 3:169845311-169845333 ATCCCAATAAAATTTCCAGATGG + Intronic
965967284 3:174508513-174508535 ATCGAAATTAAAATTTCAGCAGG - Intronic
966323144 3:178723259-178723281 ATTTCAATCAAAATTCCAGCAGG - Intronic
967000959 3:185334265-185334287 TTCCCAATCAAAATTTCAGCAGG + Intronic
967660362 3:192100810-192100832 ATCCCAATCAAAATCTCAGTAGG + Intergenic
968092081 3:195904939-195904961 ATCCCAATCAAAATCCCAGCAGG + Intronic
968715000 4:2150430-2150452 ATCCCAATGAAAATCTCAGCAGG + Intronic
968735547 4:2294051-2294073 ATCCCAATCAAAATCCCAGCAGG + Intronic
968790904 4:2661031-2661053 AGCCTAATGAAAATTTAAGATGG + Intronic
968876663 4:3271587-3271609 ATCTCAATACAAATTTCAGCAGG - Intronic
969910014 4:10435718-10435740 ATTCCAATAAAAATCTCAGCAGG + Intergenic
970236584 4:13964951-13964973 ATCCCACTGAAAATATCAAATGG - Intergenic
970595206 4:17593941-17593963 ATCTCAATCAAAATCTCAGTAGG - Intronic
970793295 4:19885635-19885657 AACCCTATCAAAATTCCAGGAGG + Intergenic
970992525 4:22229449-22229471 ATCCCAATCAAGGTATCAGCTGG + Intergenic
971199357 4:24497908-24497930 TTCCCAATCAATATTTTAAAAGG - Intergenic
971412633 4:26391120-26391142 ATCACAGTCAAAATCTCAGCAGG + Intronic
971668093 4:29519078-29519100 ATCTAAATCAAATTTTCAGTTGG - Intergenic
971747884 4:30608188-30608210 ATCCCAATTAAAATCACTGAAGG + Intergenic
971811189 4:31429915-31429937 ATCCCAATCAAAATTATTAAAGG + Intergenic
972155087 4:36150735-36150757 TTCCCAAAAGAAATTTCAGAAGG + Intronic
972235480 4:37128707-37128729 ATTACAATCAAAATTTCAATAGG + Intergenic
972248365 4:37271277-37271299 ATCCCAATCAAACTCCCAGCAGG - Intronic
972352506 4:38249047-38249069 ATCCCAGTCAAAATGCCAGCAGG - Intergenic
973197161 4:47458624-47458646 ATCTCTATCAAAATTCCAGCAGG + Intronic
973294950 4:48508295-48508317 GTCTCATTCAAAATCTCAGATGG - Intronic
973594707 4:52475468-52475490 ATCTCAATCAGAATCCCAGAAGG + Intergenic
973785699 4:54330954-54330976 AACCCAACCAAAAGATCAGATGG - Intergenic
973831705 4:54766724-54766746 ATGCCAATCAAAATCCCAGCAGG - Intergenic
973959842 4:56098929-56098951 ATCCCAAGCCAAATTTTAGGAGG - Intergenic
973973044 4:56233738-56233760 ATCCCAATCAAATTCTCATCAGG - Intronic
975377712 4:73665154-73665176 ATTCAAATCCAAATATCAGAAGG - Intergenic
975886273 4:78969241-78969263 ATTCCAATCAAAATCCCAGGAGG - Intergenic
977073754 4:92427136-92427158 ATCCGGCTCAAAATATCAGAAGG + Intronic
977898330 4:102389766-102389788 ATCCTTATCAAAATCTCAGCTGG + Intronic
978080438 4:104583535-104583557 ATTCCAACCAAAATTCCAGAAGG + Intergenic
978302208 4:107283308-107283330 ATTCCAATTAAAATTTTATAAGG - Intronic
978752907 4:112272333-112272355 TTCCCAATAAGAATTTAAGATGG + Intergenic
979370965 4:119885560-119885582 GCCCCAATCAAAATCCCAGAAGG - Intergenic
979995973 4:127431496-127431518 ATCCCTATCAAAATCCCAAATGG + Intergenic
980752527 4:137110197-137110219 ATCCCAATCAAAGTTCCAACTGG + Intergenic
981063399 4:140453295-140453317 ATTCTAATCAAAATCTCAGCAGG - Intronic
983084012 4:163421757-163421779 CTCCAAATCATAATTTAAGATGG - Intergenic
983180650 4:164644315-164644337 ATCCCATTCAAAATTACTTATGG - Intergenic
983545576 4:168959890-168959912 ATTCAAATACAAATTTCAGAAGG - Intronic
983806586 4:172000940-172000962 ATCCCAATCTTACTTTCAGAAGG + Intronic
984070293 4:175103072-175103094 AACCCTATCAAAATTTCAGCAGG - Intergenic
984424325 4:179563872-179563894 GTGCCAATCAAAATTCCAGGAGG + Intergenic
984576836 4:181459851-181459873 ATGCCAATAAAAATTTCAACAGG - Intergenic
984868403 4:184305284-184305306 ATCCCACTTAAAATTGCAGCAGG + Intergenic
984872365 4:184337677-184337699 ATCCCAATCAAAATCTCAGTAGG + Intergenic
984938488 4:184910542-184910564 AATCCAATCAAAATCTGAGAGGG - Intergenic
985112667 4:186562080-186562102 ATATCAATCAAAATTCCAAATGG - Intergenic
985211068 4:187595116-187595138 ATCCCTATCAAGAATTCAGCAGG + Intergenic
985294431 4:188420026-188420048 ATTCCAATCAAAATATCAGCAGG - Intergenic
985522235 5:380370-380392 ATCTCAATCAAAATCCCAGCAGG - Intronic
985909829 5:2870322-2870344 ATCCCAATCAACATTCCAATTGG + Intergenic
986042209 5:4004785-4004807 AGCCCAGTCAAACTTTCAGGAGG + Intergenic
986462519 5:7986673-7986695 ATCTCAATTAAAATTCCAGCAGG - Intergenic
986621062 5:9675275-9675297 ATCCCAATCAAAATCCCAGCAGG + Intronic
987869874 5:23602447-23602469 ATCCTAATCAAAATTCTAGCAGG + Intergenic
988106528 5:26756742-26756764 ATTTCTATCAAAATTTCAGCTGG + Intergenic
988637509 5:33001560-33001582 ATCCCAATCAAAAGGCCAGCAGG - Intergenic
988710256 5:33766742-33766764 ATCCCAATCAAAGTTGGAAATGG + Intronic
989063084 5:37429885-37429907 ATCTCAACCAAAATCTCAGCAGG - Intronic
989174387 5:38508482-38508504 ATCCCAATCAAAACGCCAGCAGG + Intronic
989311118 5:40019141-40019163 ATCCCAATCAACATCTCAATAGG + Intergenic
989377072 5:40775462-40775484 ATCACCATGAAAATATCAGATGG + Exonic
989515255 5:42336323-42336345 ATCCCAATTAACATCTCAGCAGG + Intergenic
989521548 5:42408036-42408058 ATCTCCATGAAAATTTTAGAGGG + Intergenic
990565511 5:57023854-57023876 ATCCCAATCAAAAGTCCAGCAGG + Intergenic
991031938 5:62090911-62090933 ATCCCTATCAAAATTTCAGAAGG - Intergenic
991193327 5:63901984-63902006 ATCCCAATCAAAACCACAGTGGG + Intergenic
991267193 5:64734467-64734489 ATCACAATCAAAATTCCAGCAGG - Intronic
991280016 5:64902757-64902779 ATCCCAATCAAAATTCTAGCAGG - Intronic
991623639 5:68573632-68573654 ATCCCAATAAAAATATCAAAAGG - Intergenic
992543958 5:77792277-77792299 ATCCTAATCAAAATCCCAGCAGG - Intronic
992603397 5:78428660-78428682 ATCCCTATCAAAATCACAGCAGG - Intronic
992668798 5:79038024-79038046 ATCTCTATCAAAATCTCAGCTGG + Intronic
993563125 5:89437189-89437211 ATCCTAATCACAATTTCAACTGG + Intergenic
993766343 5:91863432-91863454 ATGCCATTCATATTTTCAGATGG + Intergenic
993959748 5:94282272-94282294 CTCCCAACCAAAATTCCAGGTGG + Intronic
994708751 5:103239845-103239867 ATCCCAATCAAAATAACAGGAGG + Intergenic
994916403 5:105985466-105985488 ATTTCTATCAAAATCTCAGAAGG + Intergenic
995178480 5:109206935-109206957 ACCCCAATCAAAATTCCAGCAGG + Intergenic
995380646 5:111529428-111529450 ATCCCAATTAAAATCTCAGCAGG + Intergenic
995690491 5:114820418-114820440 ATCCCAATGAAAAACCCAGAAGG + Intergenic
995994808 5:118284919-118284941 ATCCCATGCAATATTTCAGAAGG - Intergenic
996112122 5:119578085-119578107 ACCCCAATAAAAATTCCAGTTGG + Intronic
996374017 5:122783808-122783830 ATCCCAATTAAAATCTCAGCAGG - Intronic
996460659 5:123737661-123737683 ATCCCAATCAAAATCCCAGTGGG - Intergenic
996515978 5:124369560-124369582 AGCCCAATCAAAACTCTAGATGG - Intergenic
996633475 5:125664626-125664648 CTCCCAATTAAAAAATCAGATGG - Intergenic
996925266 5:128818358-128818380 ATTCCTCTCAAAATTTCAGCTGG + Intronic
997057038 5:130456484-130456506 ATCTCATTCAAAATTTTAGCAGG - Intergenic
997156929 5:131571667-131571689 TTCCCAATCAAAACCTCAGCAGG + Intronic
997671766 5:135680386-135680408 ATCCTAATCAAAATGTCAACAGG - Intergenic
997682981 5:135769234-135769256 ATTGCAAACAAAATTACAGAGGG - Intergenic
997760057 5:136437201-136437223 ATCCCAATCAAAATCTTAGCAGG - Intergenic
998050748 5:139031644-139031666 ATTCCTATCAAAATTTCAGCAGG - Intronic
998076679 5:139242150-139242172 ATCTCTATCAAAATCTCAGCTGG + Intronic
998309890 5:141118329-141118351 ATCCCTATCAAAATTTCAGTTGG - Intronic
998510007 5:142704912-142704934 ATGAGAATTAAAATTTCAGAAGG - Intergenic
998572130 5:143270953-143270975 ATCACAATAAAAATTCCAGCAGG - Intergenic
998664314 5:144278852-144278874 ATCCAAATGCAAATTTCAGCAGG - Intronic
998943666 5:147313513-147313535 ATCCCCATCAAAATCTCAGCTGG + Intronic
999118670 5:149188816-149188838 ATCCCTATCAAAATCTCAGCTGG + Intronic
999168443 5:149571588-149571610 ATCCTAATCAAAATCACAGTAGG + Intronic
999333847 5:150698151-150698173 ATCCCAATCAGAAGCTCACAGGG - Intronic
999634488 5:153606439-153606461 ATCCCAATTAGAATTTCTGTAGG - Intronic
999915940 5:156260287-156260309 ATCCTTATCAAAATTTCTAAAGG - Intronic
1000588599 5:163130408-163130430 TTCTGAATCAAAATCTCAGAGGG + Intergenic
1000713960 5:164616931-164616953 ATACAAATTAAACTTTCAGAAGG + Intergenic
1000781223 5:165484462-165484484 ATCCCCATCAGAATTTTACAGGG + Intergenic
1001189832 5:169619418-169619440 ATCCAAATCAAAATTCTAGCAGG + Intergenic
1001325990 5:170724918-170724940 ATCTCAATCAAAATCCCAGCAGG + Intronic
1001479025 5:172074146-172074168 ATCCCAATCAAAAACTCAGCAGG + Intronic
1001499719 5:172221198-172221220 ATCCCAATCAAAATCCCAGAAGG + Intronic
1002344732 5:178540615-178540637 ATCTCATTCAAAATCTCAGCAGG + Intronic
1002462936 5:179385156-179385178 ATCCTGATCAAAATTCCAGCTGG - Intergenic
1003055522 6:2815214-2815236 ATCCCAGTCAGAATCTCAGCAGG - Intergenic
1003137215 6:3443018-3443040 ATCCCAAACAAAATTGCTCAGGG + Intronic
1003424372 6:5987838-5987860 ACCCCAGTCAAAACTTTAGACGG - Intergenic
1003703063 6:8492411-8492433 ATCCCAAAAGAAAATTCAGATGG + Intergenic
1003814025 6:9816963-9816985 TTCCCCATGAAATTTTCAGAAGG + Intronic
1004211075 6:13644841-13644863 ATCCCAATCAAAATATTAGAAGG + Intronic
1004305179 6:14494349-14494371 ATCCCAATAAAAATTTCAGCAGG - Intergenic
1004984766 6:21068749-21068771 ATCTTAATCAAAATTCCAGCAGG - Intronic
1005519559 6:26587535-26587557 ATCCCAATAAAAATCCCAGTGGG - Intergenic
1005861143 6:29902228-29902250 ATCCCTATCAAAATCCCAGCAGG + Intergenic
1006431125 6:33996584-33996606 ATCCCAATCACAATGCCAGTAGG + Intergenic
1006487740 6:34357717-34357739 ATACTAATCAAAATCTCAGCAGG - Intronic
1007233239 6:40367491-40367513 ACCCCAATCAAAATTTCAGCAGG + Intergenic
1007364393 6:41381125-41381147 ATTCCAATCAAAATCCCAGCAGG + Intergenic
1007508581 6:42357659-42357681 ATTCCATTCACAATTTCACACGG + Intronic
1007538798 6:42621839-42621861 ATCTCAATCAAAATATATGAAGG - Intronic
1007734909 6:43975627-43975649 ATACCAATCAAAATCCCAGCAGG - Intergenic
1008038088 6:46767898-46767920 ATCCCAATCCAAATACCAGAAGG + Intergenic
1008341604 6:50371297-50371319 ATCCTTATTAAAATTTCTGATGG - Intergenic
1008996002 6:57659908-57659930 ATCTCAATCTTTATTTCAGAAGG + Intergenic
1009184532 6:60558685-60558707 ATCTCAATCTTTATTTCAGAAGG + Intergenic
1010040171 6:71372422-71372444 GTCCCAATCAAAATGTAAGCAGG - Intergenic
1010532318 6:76983637-76983659 ATCCAAAGGAAAATTACAGATGG + Intergenic
1010748961 6:79596727-79596749 ATCCTTATCAAAATTCCAGCTGG + Intergenic
1011080308 6:83483349-83483371 ATCCCAATCAAAATCCCAGCAGG + Intergenic
1011206134 6:84900612-84900634 ATCCCAATCAAAATCCCAGCAGG - Intergenic
1011956563 6:93031216-93031238 CTCCTATTCAGAATTTCAGAGGG - Intergenic
1011967984 6:93183829-93183851 AGCCCATTCAAAATCTCCGAAGG + Intergenic
1012944730 6:105453132-105453154 AACCAAATCAAAAATTGAGAAGG - Intergenic
1014136948 6:117900674-117900696 ATCCCTATAAAAATCTCAGCAGG - Intergenic
1015647791 6:135413946-135413968 GTCCCACTCAAAATTCCAGCAGG + Intronic
1016297704 6:142592810-142592832 ATCACAATCACAATCTCAGAAGG + Intergenic
1016432549 6:144002860-144002882 ATCCCAATCAAAATTCTGGTAGG + Intronic
1016598812 6:145832751-145832773 CTCCCTATCACCATTTCAGAAGG + Intergenic
1016608040 6:145956850-145956872 ATCCCATTCAAAATTCCAACAGG + Intronic
1016613112 6:146015862-146015884 ATCTCAATCAAAATTTAAAATGG + Intergenic
1016664691 6:146623222-146623244 ATCTCAATCAAAATCCCAGCAGG - Intronic
1018347351 6:162914614-162914636 ATCCTAAACAAAATTCCAGCAGG - Intronic
1018589230 6:165399277-165399299 AACCCAATCAAAATCCCAGTAGG + Intronic
1018657153 6:166048448-166048470 ATCCCAATAAAAATCCCAGCAGG - Intergenic
1018751328 6:166808822-166808844 ATTCCAATCAAAATTCTAGCTGG + Intronic
1018773325 6:166991640-166991662 GTCCCAGTCAAAAGATCAGAAGG - Intergenic
1018881032 6:167881002-167881024 AACCCAATCACAATCTCAGAAGG - Intronic
1019418998 7:941743-941765 ATCCCAATCAGAATTTCAACAGG + Intronic
1019974547 7:4570257-4570279 ATCCCAATCAAAATTCCAGCTGG + Intergenic
1020359452 7:7312194-7312216 ATCCCAATCAAAATCTCAGTAGG - Intergenic
1021388466 7:20062020-20062042 ATCCCAATCAGAATCCCAGCAGG + Intergenic
1021743119 7:23708244-23708266 ATCCCAATCAAAATCACAGCAGG + Intergenic
1021751282 7:23802862-23802884 ATTCCAATCAAAATCACAGCAGG - Intronic
1022161192 7:27712963-27712985 ATCCTAATCACAATTCCACAAGG + Intergenic
1022361347 7:29662311-29662333 ATCCCAACCAAAATCCCAGCAGG - Intergenic
1022407231 7:30101860-30101882 ATCCCAATCTAAATACCAGCAGG + Intronic
1022436734 7:30394021-30394043 ATCCCAATCAAAATCCCAGTAGG - Intronic
1022935981 7:35177126-35177148 ATCCCAATCAAAATCACAGCAGG + Intergenic
1023129611 7:36989403-36989425 TCCCCAATCAGAATTTCAGGGGG + Intronic
1023547728 7:41336479-41336501 ATCTGAATTCAAATTTCAGAGGG + Intergenic
1023669911 7:42564827-42564849 ATACCAATCAAAATATCAGTAGG - Intergenic
1023887650 7:44371992-44372014 ATCCCAATAAAATTCTCAGCAGG - Intergenic
1023997278 7:45167979-45168001 ATCCCTATCAAAATCGCAGCTGG - Intronic
1024786728 7:52915827-52915849 ATCCCCATCAAAATTCCAGTGGG - Intergenic
1024836849 7:53530751-53530773 AGCCCAACTAAAAATTCAGAAGG + Intergenic
1024878642 7:54058119-54058141 ATCTAAATCAAAATTCCAGAAGG + Intergenic
1025004968 7:55346372-55346394 ATCCCAATCAGAATCCAAGAAGG + Intergenic
1025831198 7:65052024-65052046 ATTCTAATCAAAATCTCAGTGGG - Intergenic
1025918346 7:65885904-65885926 ATTCTAATCAAAATCTCAGTGGG - Intronic
1025934034 7:66019854-66019876 ATCCCAATCAGAATCTCAGTAGG + Intergenic
1025949947 7:66136708-66136730 ATCCCAATCAGAATCTCAGCAGG - Intronic
1026061048 7:67026545-67026567 ATCCCAATAAAAATTCTAGTAGG + Intronic
1026276366 7:68880923-68880945 ATTTCAATCAAAATCTCAAAAGG - Intergenic
1026717315 7:72800854-72800876 ATCCCAATAAAAATTCTAGTAGG - Intronic
1027820666 7:83039735-83039757 ATCTCTATCAAAATTTAAGCTGG - Intronic
1028139053 7:87252300-87252322 ATTCCAATCAAGAGCTCAGATGG + Intergenic
1028358360 7:89937067-89937089 ATCTCAATCAAAATTCCAGTAGG - Intergenic
1028499714 7:91505928-91505950 ATCCCAATCAAAGTCCCAGCAGG + Intergenic
1028591871 7:92505492-92505514 ATCCCATTGAGAATTTTAGATGG + Intronic
1028759952 7:94484683-94484705 ATCCATAGAAAAATTTCAGAAGG - Intergenic
1028854137 7:95571048-95571070 ATCCTAATCAAAATCCCAGTAGG - Intergenic
1029593621 7:101524521-101524543 ATCCCAGTAAAAATTGCAGCTGG - Intronic
1029602079 7:101572498-101572520 ATCGCTATCAAAATTTCAGCTGG - Intergenic
1029674131 7:102054985-102055007 ATGCCTATCAAAATTCCAGCTGG - Intronic
1029831947 7:103269844-103269866 ATCCCAATCAAAATCACAGCAGG + Intergenic
1030252751 7:107465549-107465571 ATACCAATCAAAATAACAGCAGG + Intronic
1030483994 7:110142493-110142515 ATACCAATCAAAGTTTCTGTTGG - Intergenic
1030545986 7:110895566-110895588 ATCCCAATCAAACTCCCAGCAGG - Intronic
1031456171 7:121982420-121982442 ATCCTAATTAAAATCCCAGAAGG - Intronic
1031818122 7:126465376-126465398 ATCCTAATCAAAATCCCAGTAGG - Intronic
1031823948 7:126539394-126539416 ATCCCAGTCAAAATCTCAGCTGG + Intronic
1031950970 7:127891844-127891866 TTCCCAAGCAAAATTTCTTAAGG + Intronic
1032421134 7:131780704-131780726 ATGCCAATTAAAATTCCAGCAGG - Intergenic
1032597927 7:133260676-133260698 ATCCCAATCAAAATCCCAGCAGG - Intronic
1033026533 7:137778955-137778977 ATCCCAATCATAACTCCAGCAGG + Intronic
1033103309 7:138496137-138496159 ATCCCAATTAAAATCCCAGCAGG - Intronic
1033194189 7:139313169-139313191 ATCCTAATCAATATTTCAACTGG - Intergenic
1033468348 7:141619148-141619170 ATCCCAATCAATGTTTCACAAGG + Intronic
1033525078 7:142203999-142204021 ATTACAGTCAAAATTCCAGAAGG - Intronic
1033724357 7:144097457-144097479 ATCCCAATCAATATCGCAGCAGG + Intergenic
1034372655 7:150613558-150613580 AGTCCAATCAAAATCTGAGAGGG - Intergenic
1034947806 7:155274836-155274858 CTCCCAAACAACATTTCAGGTGG + Intergenic
1035545106 8:474592-474614 ATGCAAATCAAAATCTCAGCAGG - Intergenic
1036006271 8:4667392-4667414 ATCCAAATCAAAATATCAGCAGG - Intronic
1036553658 8:9838290-9838312 ATCCCAACCAAAATCTCAGCAGG + Intergenic
1037012730 8:13864172-13864194 ATTCCAATCAAAAGTTCACCAGG - Intergenic
1037960923 8:23097613-23097635 AACCCAAGCAAAACTTCAGCAGG + Intronic
1037970823 8:23170679-23170701 AACCCAAGCAAAACTTCAGCAGG - Intergenic
1037978014 8:23226774-23226796 ATCCCAATTAAAATTCCAGTAGG - Intergenic
1038241630 8:25814380-25814402 AACACAATCCAAATCTCAGAAGG + Intergenic
1038752510 8:30309127-30309149 ATCCCAGTAAAAATTCCAGCAGG - Intergenic
1039284001 8:36019911-36019933 AAACAAATCAACATTTCAGATGG + Intergenic
1039783359 8:40810202-40810224 ATTCCAATCAAGATTTCCAATGG + Intronic
1039904720 8:41777945-41777967 ATGCCAATCAACATTTCCTAAGG + Intronic
1040836759 8:51740148-51740170 ATTCCTATCAAAATTTAACAAGG + Intronic
1041356735 8:57008314-57008336 ATTCTAATGAAAATCTCAGATGG + Intergenic
1041481665 8:58328229-58328251 ATCCCAATGAAAATACCAGGAGG + Intergenic
1041951154 8:63504365-63504387 ATTCCAATCAAAATCTCAGCAGG - Intergenic
1042354108 8:67807396-67807418 ATCCTCAGCATAATTTCAGAAGG + Intergenic
1042400426 8:68339149-68339171 ATCTGAATCAAAATTCCAGCAGG - Intronic
1042421291 8:68592235-68592257 ATTCCAATCAAAATGCCATAAGG - Intronic
1042538488 8:69883468-69883490 ATCCCAATCAAAATCCTAGCAGG + Intergenic
1043510087 8:80942194-80942216 ATCCTCATCAAAATCCCAGAAGG - Intergenic
1044009960 8:86982825-86982847 ATCCCAATCAAAACCTCAGCAGG - Intronic
1044121376 8:88400720-88400742 ATCCCAATCAAAATCTTCGTTGG + Intergenic
1044176810 8:89135996-89136018 ATTTCTATCAAAATCTCAGAAGG + Intergenic
1044181093 8:89195712-89195734 ATCCCAATCAAAATTCCAATAGG + Intergenic
1044213086 8:89573584-89573606 AATCAAATCAAAATCTCAGAAGG - Intergenic
1044299850 8:90571002-90571024 ATGCCAATCAAATATTCAGCTGG - Intergenic
1044762322 8:95534272-95534294 ATTCCAATCAAAATCTCAGTAGG + Intergenic
1045145419 8:99338234-99338256 ATCCCAATCAAAATTCTAACAGG - Intronic
1045725276 8:105165508-105165530 AACCCAATCCTAATTTTAGAGGG + Intronic
1045793835 8:106019411-106019433 ATCCCAATAAAAGTCCCAGAAGG + Intergenic
1046163553 8:110398311-110398333 ATCCCAATCATAATTTCAGCGGG - Intergenic
1046557962 8:115799763-115799785 ATCCCAATCAAAATACCAGGGGG + Intronic
1046825533 8:118687409-118687431 ATGCCTATCAAAATCTCAGCAGG - Intergenic
1046839917 8:118844787-118844809 AACCAAATCAGAATTTCTGAGGG + Intergenic
1046903847 8:119551400-119551422 ATTCCAATCAAAATCCCAGTAGG + Intergenic
1046992881 8:120480140-120480162 ATGCCTATCAAAATTCCAGCAGG + Intronic
1047101703 8:121683174-121683196 ATCCCTATCAAAATCCCAGCTGG - Intergenic
1047265441 8:123303192-123303214 AACCCATTCTAAATTTCATATGG - Intergenic
1047382652 8:124377597-124377619 ATCCCAGTCAAAATCCCAGCTGG + Intergenic
1047867778 8:129046484-129046506 ATCCCAATTAAATATTCAGCAGG - Intergenic
1048025323 8:130581464-130581486 ATTTCAATCAAAATCTCAAAAGG - Intergenic
1048994473 8:139784908-139784930 ATTCCAATTAAAATTCCAGCAGG + Intronic
1049565689 8:143337454-143337476 ATCCCCATCTAAATTCCAGCTGG + Intronic
1050070495 9:1807309-1807331 ATCCCAATACAAATTTCAGCAGG - Intergenic
1050150062 9:2610648-2610670 ATCCTAATCAAAACAACAGAGGG + Intergenic
1050226453 9:3463016-3463038 ATTCCAATCAAAATCCCAGTAGG + Intronic
1050238335 9:3607076-3607098 ATCCTAAACAAAATTTCAATAGG - Intergenic
1050784255 9:9379576-9379598 ATCCCAATCAAAATTTCAGAAGG - Intronic
1051288942 9:15526081-15526103 ATACCTATCAAAATTCCAGCAGG - Intergenic
1051460704 9:17311420-17311442 TTCCCAATCAAAATCCCAGGAGG + Intronic
1051460712 9:17311478-17311500 ATCCCAATCAAACTCCCAGGAGG + Intronic
1051527801 9:18066687-18066709 ATCCTAATCAAAATAGCAGTGGG + Intergenic
1051607747 9:18932576-18932598 ATTCCTATCAAAATCTCAGAAGG - Intronic
1051817510 9:21126909-21126931 ATACCAATCAAAATTCCACCAGG + Intergenic
1052041504 9:23744109-23744131 ATCCCAATCTCAAATTCATAAGG - Intronic
1052321140 9:27169050-27169072 ATCCCCATCAATATTCCAGCTGG - Intronic
1052394233 9:27918688-27918710 ATCCCAATCATAATTCCACTCGG - Intergenic
1052689235 9:31794926-31794948 ATCAGAACCAAAATTTCATAGGG - Intergenic
1053085964 9:35222196-35222218 AACCCAATCAAAATTCTAGCAGG - Intronic
1053729313 9:41036584-41036606 ATCCCAATCAAAATCCCAGTAGG + Intergenic
1054699199 9:68395482-68395504 ATCCCAATCAAAATCCCAGTAGG - Intronic
1055015042 9:71607328-71607350 ATCCTAATCAAAATTTCCTTAGG - Intergenic
1055204774 9:73715052-73715074 ATTGCAATCAAAATCTCAGCAGG - Intergenic
1055262724 9:74457479-74457501 ATCACAATCAAAATCTCAGGAGG + Intergenic
1055787033 9:79882294-79882316 ATAACAATCATAATATCAGAAGG + Intergenic
1056828662 9:89895942-89895964 AACACCATCAAAATTTCAGAAGG - Intergenic
1057153596 9:92818403-92818425 ATGCCATTGACAATTTCAGAAGG + Intergenic
1057350879 9:94297168-94297190 ATCCCAATCAAAATCTCAGCAGG - Intronic
1057811955 9:98264818-98264840 TTCACATTCAGAATTTCAGATGG - Intergenic
1058258429 9:102799939-102799961 ATCCCATTCAAAATTCCAGAAGG - Intergenic
1058859772 9:109104501-109104523 ATCCCTATCAAAATCCCAAAAGG + Intronic
1059496815 9:114717030-114717052 GTTCCAATCAAAAGTACAGAAGG - Intergenic
1060083291 9:120673282-120673304 ATCCCAATCAAAATCCCAGAAGG + Intronic
1060433646 9:123573324-123573346 ATCCCAACCCAAATTCCAGATGG - Intronic
1060447520 9:123704958-123704980 ATTCTAATCAAATTTCCAGAAGG + Intronic
1060774215 9:126358351-126358373 ACTCCAATCAAAATCCCAGAAGG - Intronic
1061220762 9:129249820-129249842 ATCCCTATCAAAATTCCAGTTGG + Intergenic
1061819155 9:133215369-133215391 ATTTCTATCAAAATTCCAGAAGG + Intergenic
1061998374 9:134201362-134201384 ATCTCGATCAAAATCTCAGCAGG + Intergenic
1062441958 9:136574410-136574432 ATACCAAAATAAATTTCAGATGG - Intergenic
1185470568 X:379790-379812 ATCCCAATCAAAATTCCAACAGG + Intronic
1186549701 X:10490082-10490104 ATCTCAATGAAAATTCCAGCAGG - Intronic
1186770563 X:12814016-12814038 ATTCCAAAATAAATTTCAGATGG - Intronic
1187206897 X:17190572-17190594 ATCCTAATCAAAATTCCAGCAGG + Intergenic
1187382130 X:18812522-18812544 ATCCCTATCAAATTCTCAGCTGG - Intronic
1187436060 X:19270647-19270669 ATCTCAATCAAAATCTCAGCAGG + Intergenic
1187483322 X:19678327-19678349 ATCTCAATCAAAATTCCAGGAGG + Intronic
1187582600 X:20624709-20624731 ATCCCAATCATAATCTCATGGGG - Intergenic
1187908481 X:24088987-24089009 ATCCCTAACAAAATTCCAGAAGG - Intergenic
1188134504 X:26478460-26478482 ATCTCCATCAAAATCTCAGCAGG + Intergenic
1188180935 X:27054645-27054667 ATCCCAATCAAAATCCAAGCAGG - Intergenic
1188346737 X:29076546-29076568 CTCCAAATAAAGATTTCAGAAGG - Intronic
1188955441 X:36430302-36430324 AACACAATCAAAATATCAGCAGG - Intergenic
1189106934 X:38246170-38246192 GTCCAAATCAAAATCTCAGTAGG + Intronic
1189446072 X:41083074-41083096 ATCCCTATCAAAATCCCAGCAGG - Intergenic
1189525651 X:41818118-41818140 ATCCCAATAAAAATCCCAGGAGG + Intronic
1189828399 X:44944458-44944480 ATTTCAATCAAAATTCCAGCAGG - Intronic
1190379384 X:49825054-49825076 TTCTCAATCAAAATTACTGAAGG + Intergenic
1190551277 X:51584078-51584100 ATCCCCATCAAAGTTCCAGCAGG - Intergenic
1190849922 X:54229463-54229485 ATTCCAATCAAAATCACAGCAGG + Intronic
1190885026 X:54524081-54524103 ATCCCAATCAAAATCCCAGTTGG + Intergenic
1190962450 X:55266320-55266342 ATTCCAATCAAAATCCCAGAGGG + Intronic
1191202394 X:57797776-57797798 ATCACTATAAAAATTTCAAAAGG - Intergenic
1191668044 X:63723435-63723457 ACCCCAAACAAAAGGTCAGAAGG - Intronic
1192163940 X:68811973-68811995 ATCCCTATTAAAATCCCAGATGG + Intergenic
1192272315 X:69593415-69593437 ATCCCAATCAAAATCCCTGAAGG + Intergenic
1192375862 X:70561051-70561073 ATCCCAATCAAAATCCCAGCTGG - Intronic
1192402563 X:70851046-70851068 ATCCCTATCAAAATTCCAGCTGG + Intronic
1192545896 X:72013075-72013097 ATCTCTATCAAAATTCCAGGAGG - Intergenic
1192573526 X:72224999-72225021 CTCCCAATCAAAAAACCAGATGG + Intronic
1192605965 X:72517924-72517946 ATCTCTATCAAAATTCCAGCTGG - Intronic
1192668624 X:73115534-73115556 ATCTCATTCAATATTCCAGATGG - Intergenic
1192708740 X:73557397-73557419 ATTCCTATCAAAATTCCAGCTGG + Intergenic
1192750173 X:73982081-73982103 ATCCCTATCAAAATCCCAGAAGG - Intergenic
1192773072 X:74214010-74214032 TTCACAATAAAACTTTCAGATGG + Intergenic
1193348979 X:80435084-80435106 ATAGCATTCAAAGTTTCAGAAGG - Intronic
1193552439 X:82913179-82913201 ATCCCTATCAAAATTCCAAAAGG + Intergenic
1193562992 X:83042715-83042737 ATCACTATCCAAATCTCAGATGG + Intergenic
1193679999 X:84506874-84506896 ATCACAATGAATATTTTAGAAGG - Intergenic
1194101798 X:89715568-89715590 AACTCAATCAGAATTTCAGTAGG + Intergenic
1194187708 X:90793654-90793676 ACCTGAATCAAAAGTTCAGATGG - Intergenic
1194419783 X:93659651-93659673 ATGCCAATCTAAATATCAGTAGG + Intergenic
1194769852 X:97888759-97888781 ATCCTAATCCAAATTCCAGCAGG - Intergenic
1194910639 X:99639484-99639506 ATTCCAATCAAAATCTCAACAGG + Intergenic
1194936285 X:99953042-99953064 AACCCAGTAAAAATTTCAGTGGG - Intergenic
1195204957 X:102588991-102589013 ATCCCTATCAAAATTTCAGCAGG - Intergenic
1195395210 X:104403059-104403081 ATCCCAATCAAAATCTCAGCAGG - Intergenic
1195553585 X:106195830-106195852 ATCTCAATCAAAATCCCAGTAGG - Intronic
1195919553 X:109969584-109969606 ATTTCAATAAAAATTTCAGAAGG - Intergenic
1195928345 X:110048791-110048813 ATCCAAATCTAAATTACAGAAGG - Intronic
1196279836 X:113811502-113811524 ATCACAATCAAACTTCCAGAAGG + Intergenic
1196313275 X:114194151-114194173 ATCCCAAACAAAATCCCAGAAGG + Intergenic
1196370176 X:114968849-114968871 ATCCCAATACAAATATCAGCAGG + Intergenic
1196420109 X:115512690-115512712 ATCCACATCCAAATGTCAGAGGG + Intergenic
1196532943 X:116810896-116810918 ATAGGAATAAAAATTTCAGATGG + Intergenic
1196604324 X:117638973-117638995 ATGCAAATTAAAATTACAGAGGG + Intergenic
1197012051 X:121577205-121577227 ATCCCAATAAAAATTCCAGTGGG + Intergenic
1197354141 X:125414789-125414811 ATCCCTAACAAAATCTCAGTAGG - Intergenic
1197472061 X:126876673-126876695 ATGCCAAATAAAAATTCAGAAGG - Intergenic
1197577400 X:128232578-128232600 ATACAAATCAAAATTACAAAGGG + Intergenic
1197730837 X:129808170-129808192 ATCCCCATCAAAATTCCAGCTGG + Intronic
1197801130 X:130350351-130350373 ATCCCACACACAAATTCAGAAGG - Intronic
1197866183 X:131020213-131020235 ATCCCATTCAAAATCCCAGTAGG - Intergenic
1197968323 X:132088946-132088968 ATCCCCATCAAAATCCCAGTAGG + Intronic
1198176886 X:134165543-134165565 ATTCCAATCAACATCTCAAAGGG - Intergenic
1198189303 X:134286785-134286807 ATTCCATACAAAATTTAAGATGG + Intergenic
1198451556 X:136771297-136771319 ATCACTATCAAAATCTCAGCTGG + Intronic
1198510431 X:137345135-137345157 ATCCCAGTCAAAACTCCAGCAGG + Intergenic
1198822833 X:140667054-140667076 ATCTCTATCAAAATCTCAGCAGG - Intergenic
1199006514 X:142704767-142704789 ATCCCAATGAAAATATCAGCAGG + Intergenic
1199082176 X:143589338-143589360 CTCCCACTCAAAACTTCAAAAGG - Intergenic
1199140609 X:144307214-144307236 ATCCAAATATTAATTTCAGAAGG - Intergenic
1199405879 X:147459944-147459966 AACTCAATCAAAATTTCAGCAGG + Intergenic
1199682176 X:150233531-150233553 ATCCCAATAAAAATTCAAGCAGG + Intergenic
1199688603 X:150288219-150288241 ATTCCTATCAAAATTCCAGCAGG + Intergenic
1199824163 X:151481222-151481244 ATCCCGATAAAAATCTCAGAAGG + Intergenic
1199889691 X:152065097-152065119 ATCCCAGTCAAAATACCAGCAGG - Intergenic
1200307007 X:155037010-155037032 ATCCCAGTCAAAATCTCATCGGG - Intronic
1200395573 X:155984936-155984958 AGTCCAATCAAAATCTGAGAGGG - Intergenic
1200534295 Y:4375606-4375628 ACCTGAATCAAAAGTTCAGATGG - Intergenic
1201376390 Y:13325786-13325808 ATCCCAGTCAATATTTGAGAAGG + Intronic
1201970824 Y:19792660-19792682 ATTCCAAGCAAACTATCAGAAGG - Intergenic
1202582946 Y:26401435-26401457 AGCCCAATCATAGTTTTAGAAGG - Intergenic