ID: 1050784257

View in Genome Browser
Species Human (GRCh38)
Location 9:9379603-9379625
Sequence TTGAATCTACAGATGAAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050784252_1050784257 15 Left 1050784252 9:9379565-9379587 CCATAAATTAACCTTCTGAAATT 0: 1
1: 0
2: 3
3: 37
4: 499
Right 1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG No data
1050784255_1050784257 4 Left 1050784255 9:9379576-9379598 CCTTCTGAAATTTTGATTGGGAT 0: 1
1: 3
2: 44
3: 213
4: 683
Right 1050784257 9:9379603-9379625 TTGAATCTACAGATGAAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050784257 Original CRISPR TTGAATCTACAGATGAAGTT GGG Intronic
No off target data available for this crispr