ID: 1050784257 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:9379603-9379625 |
| Sequence | TTGAATCTACAGATGAAGTT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1050784252_1050784257 | 15 | Left | 1050784252 | 9:9379565-9379587 | CCATAAATTAACCTTCTGAAATT | 0: 1 1: 0 2: 3 3: 37 4: 499 |
||
| Right | 1050784257 | 9:9379603-9379625 | TTGAATCTACAGATGAAGTTGGG | No data | ||||
| 1050784255_1050784257 | 4 | Left | 1050784255 | 9:9379576-9379598 | CCTTCTGAAATTTTGATTGGGAT | 0: 1 1: 3 2: 44 3: 213 4: 683 |
||
| Right | 1050784257 | 9:9379603-9379625 | TTGAATCTACAGATGAAGTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1050784257 | Original CRISPR | TTGAATCTACAGATGAAGTT GGG | Intronic | ||
| No off target data available for this crispr | |||||