ID: 1050797657

View in Genome Browser
Species Human (GRCh38)
Location 9:9564353-9564375
Sequence ACTTGTTTCTAAAGGGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 137}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050797657_1050797664 17 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797664 9:9564393-9564415 GGCATAACAGAGTTGGCATGAGG No data
1050797657_1050797666 26 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797666 9:9564402-9564424 GAGTTGGCATGAGGAATGCAGGG No data
1050797657_1050797665 25 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797665 9:9564401-9564423 AGAGTTGGCATGAGGAATGCAGG No data
1050797657_1050797660 -4 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797660 9:9564372-9564394 AAGTTAACTCAGAATCTCCCTGG No data
1050797657_1050797661 10 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797661 9:9564386-9564408 TCTCCCTGGCATAACAGAGTTGG No data
1050797657_1050797668 28 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797668 9:9564404-9564426 GTTGGCATGAGGAATGCAGGGGG No data
1050797657_1050797667 27 Left 1050797657 9:9564353-9564375 CCTGTTACCCTTTAGAAACAAGT 0: 1
1: 0
2: 0
3: 7
4: 137
Right 1050797667 9:9564403-9564425 AGTTGGCATGAGGAATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050797657 Original CRISPR ACTTGTTTCTAAAGGGTAAC AGG (reversed) Intronic
904395260 1:30216152-30216174 ACTTGTGTTCAAAGAGTAACTGG - Intergenic
907696347 1:56733672-56733694 ACTTGTTTCTGAATGATTACTGG - Intronic
909726367 1:78840845-78840867 ACTTACTTCTAGAGGGTCACTGG - Intergenic
910048009 1:82940649-82940671 ACATGCTTATAAAGGGTAAAAGG + Intergenic
910390042 1:86732259-86732281 AGTTTTTTCTAAAATGTAACTGG - Intronic
910419617 1:87044457-87044479 ACTTGTTTTTAAATGTTAAATGG - Intronic
910811745 1:91244848-91244870 TCTAGTTTCTAAATGGTAAAAGG + Intergenic
912268725 1:108187786-108187808 ACTTGATTCTAAAACCTAACAGG + Intronic
918585344 1:186181008-186181030 AATTGATTCTAAAGCATAACAGG + Intronic
919062168 1:192646957-192646979 ACTATTTTCTAAATGGTAAATGG + Intronic
1064448052 10:15414108-15414130 ACTTTTTTCTAAATGGGAAAAGG - Intergenic
1064778822 10:18810551-18810573 TTTTGTTTTTAAAGGGTGACAGG - Intergenic
1065420060 10:25533312-25533334 ATTTTTTTCTTAAGGTTAACAGG - Intronic
1071137204 10:82466528-82466550 ACCTGCTTCTAAAGGTAAACAGG + Intronic
1071457910 10:85864917-85864939 ATGTGTTTCTAAGGGGTGACAGG - Intronic
1073724777 10:106217627-106217649 AATTGTTTCTTAAGGGGAAAAGG + Intergenic
1077959328 11:7057158-7057180 AATTGTTTCTAAAGATTAAAAGG - Intronic
1078426423 11:11254488-11254510 ACATTTTTCTAGAGGGTACCTGG - Intergenic
1082918542 11:58466336-58466358 ACTTGTTCCTAAAAGCAAACAGG + Intergenic
1087608591 11:100407087-100407109 TCATTCTTCTAAAGGGTAACTGG - Intergenic
1089048853 11:115528403-115528425 TCCTGTTTCTAAGGGGGAACTGG - Intergenic
1089434204 11:118449726-118449748 CCTTCTTTCTAAAGGTAAACAGG - Intronic
1092139712 12:6174918-6174940 ATTTATTTCTACAGGGTTACTGG - Intergenic
1092378015 12:7971643-7971665 AATTGTTTTTAAAGGGGAAGGGG - Intergenic
1094050354 12:26213669-26213691 ACTTTTTTTTAAAGGGTTGCTGG + Intronic
1094718716 12:33039246-33039268 ACTTGTTTCTTGAGTGTTACAGG - Intergenic
1095347241 12:41165706-41165728 ATTTTTTTATAAATGGTAACAGG - Intergenic
1095882673 12:47154896-47154918 AGTTGTTTCTAAATGGAACCAGG - Intronic
1100077767 12:90807757-90807779 ACTTTTTTATAAAGGGTACAGGG - Intergenic
1104604494 12:130177921-130177943 TCCTGTTTCTAAGGGGGAACAGG + Intergenic
1105339841 13:19511559-19511581 ATTGGTTTCTAAAGGGCATCAGG + Intronic
1106587003 13:31066382-31066404 ACATGTTTCTCAAGGGTAGCTGG + Intergenic
1107110727 13:36694925-36694947 ACTTGTTTCTCAAAGGCAGCAGG - Exonic
1107315287 13:39125013-39125035 ATTTGTTTCTGAAGTGCAACTGG + Intergenic
1107653484 13:42568553-42568575 AGTTGCTTGTAAAGGGTAATGGG + Intronic
1107969497 13:45627699-45627721 ACTTTTTTCTAAAGAACAACAGG + Intergenic
1108823740 13:54386515-54386537 ATTTGTGTCTAAAGCGTAAATGG - Intergenic
1109628047 13:65004377-65004399 ACATGTTACTAAAGGTAAACTGG + Intergenic
1111175402 13:84588979-84589001 ACCTGTTTCTATAGGATAAAAGG + Intergenic
1114244141 14:20896770-20896792 ACTTGTTTCTAAACTAAAACTGG + Intergenic
1118912899 14:70076669-70076691 ACTTGTTTGGGAAGGGAAACAGG - Intronic
1119846555 14:77834783-77834805 ACCTGGTTCTACAGGGTAAGTGG + Intronic
1125261240 15:37827358-37827380 AATTGTTTCCAAAGGGTTTCAGG - Intergenic
1125406472 15:39357345-39357367 ACTTGTTTTAAAAATGTAACAGG + Intergenic
1125506591 15:40271148-40271170 ACGTGTTTTTAAAGGGCACCTGG - Intronic
1125619367 15:41046070-41046092 ACTTGTTTCTACAGGGCAAACGG - Intronic
1126060810 15:44780576-44780598 ACATTTTGCTAAAGGGAAACAGG + Intergenic
1128473585 15:67977371-67977393 TCTTGTTACCAAAAGGTAACAGG + Intergenic
1130774970 15:86969373-86969395 ACTAGTTTCTAAAGGAGAGCAGG - Intronic
1143253821 17:5541343-5541365 ACTTGTTTCTACATGGTGGCGGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144605011 17:16657383-16657405 ACTCATGTCCAAAGGGTAACAGG - Intergenic
1144701537 17:17343992-17344014 ACTTTTTCCTATAGGGTAGCAGG - Intronic
1148952603 17:51326981-51327003 ACATGTTTCTTAAGAGAAACAGG - Intergenic
1150036023 17:61798950-61798972 CCTTGTTTTTAAAGCTTAACTGG + Intronic
1151585425 17:75005447-75005469 ATTTATTTCTAATGGGTAAAGGG + Exonic
1153621466 18:6982557-6982579 CCTTGTTTCTAACGGGAAAGCGG - Exonic
1153690652 18:7589997-7590019 ACTTGTCTCTAATGGGAAGCAGG + Intronic
1157014470 18:43694306-43694328 AGTTGATTCCAATGGGTAACTGG + Intergenic
1158857276 18:61555227-61555249 CCTTGTCTCAAAAGGGTTACGGG - Exonic
1162492600 19:11002661-11002683 ACCTGTTTCTTTAAGGTAACTGG - Intronic
1167977544 19:53242542-53242564 ACATGTGTCTAAAGGGGAATGGG - Intronic
1168127341 19:54292759-54292781 TCTTTATTCTAGAGGGTAACTGG + Intergenic
927694411 2:25230460-25230482 CCTTGTTTCTAAGGGGGAAATGG + Exonic
929902945 2:46021572-46021594 TCTTGTTTCTAATCGGTAAGGGG - Intronic
939140966 2:138354212-138354234 ACTTGTTTCTGATGAGCAACAGG - Intergenic
939515097 2:143156477-143156499 ACATGTTTCTGCAGGGTGACTGG - Intronic
943807176 2:192136771-192136793 ACTTATTTCCAAATGGAAACAGG - Intronic
945584701 2:211645204-211645226 ACTTGATAATAAAGGATAACTGG - Intronic
1169556186 20:6752764-6752786 CTTTGTTTCTAAAGGTAAACAGG - Intergenic
1171396012 20:24833681-24833703 CCTTTTTTCTGAAGGGTAACTGG - Intergenic
1175599781 20:60263815-60263837 ACTAGATTCTAGAGGTTAACTGG - Intergenic
1184450452 22:44579454-44579476 ACTTGATGCTTAAGGGGAACTGG - Intergenic
950034331 3:9874194-9874216 ATTTGTTTCAAAAGGGACACAGG - Intronic
952311584 3:32195280-32195302 ACTTTTTTCCAAAGGGTTCCTGG - Intergenic
952527528 3:34226317-34226339 ACATTTTGCTAAAGGGAAACAGG - Intergenic
955551718 3:60092221-60092243 ACTTGTTTCATAATTGTAACTGG + Intronic
956055840 3:65297859-65297881 ACTTGAATCTAACTGGTAACTGG + Intergenic
958856839 3:99395491-99395513 TCTTGATTATAAAGGGTAAAAGG - Intergenic
959365197 3:105449084-105449106 ACATGTTTCTACATGGTAAAAGG + Intronic
959594383 3:108113854-108113876 AATTGTTCCTAAATGGGAACTGG + Intergenic
959907437 3:111725512-111725534 CCTTGTTTCTAGAAGGAAACTGG - Intronic
961250074 3:125494787-125494809 AATTGTTTGTAATGGTTAACTGG - Intronic
962462813 3:135630314-135630336 ACTTTCTTCTAAAGGGTCTCAGG - Intergenic
964086484 3:152825252-152825274 ACCTTTTTCTAAAGGATGACAGG - Intergenic
964176884 3:153834548-153834570 ATTGGCTTCTAAAGCGTAACAGG + Intergenic
966111382 3:176406033-176406055 ACTTGTCACTAAAAGGTACCAGG - Intergenic
970619304 4:17800886-17800908 ACTGGTTTCTAAAATGTTACAGG - Exonic
971686432 4:29775312-29775334 AATTGTGTTTAAAGAGTAACAGG - Intergenic
974682996 4:65188666-65188688 ACTTGTTTCTAAAAGATTAAAGG - Intergenic
975171141 4:71232940-71232962 TCTTTTTTCTAAAGGGGAGCTGG + Intronic
975814921 4:78207516-78207538 TCTTGTTTTTAAAGGGGAAGAGG + Intronic
975880979 4:78907559-78907581 AGTTGGTTTTAAAGGTTAACAGG + Intronic
977796935 4:101177225-101177247 AGGTGTTTTTAAAGGGTAGCAGG + Intronic
978148297 4:105403865-105403887 ACTTGTTTCTAAAATCTAATTGG + Intronic
982150389 4:152448799-152448821 CCTTCTTTCTAAAGAGTAGCTGG - Intronic
983610072 4:169632800-169632822 GTTTGTTTCTTAAGGGTAGCAGG + Intronic
984416301 4:179463167-179463189 TGTTGTTTGTAAAGGGTAAGTGG - Intergenic
986599514 5:9457814-9457836 ACATGTTTTGAAAGGGTCACAGG + Intronic
990424124 5:55668344-55668366 TCTGGTTTCTAAATGGTAAGAGG - Intronic
991356746 5:65776522-65776544 ACTTGTTTCTAAAGCCTTATAGG - Intronic
991533700 5:67643056-67643078 ACTTGTCTCTTAAGGTTGACTGG - Intergenic
998583921 5:143405512-143405534 CCTTGGTTCTCAAGGGTAAACGG + Intronic
999069493 5:148728804-148728826 AATGGTTTCTAAAAGGTAATGGG - Intergenic
999827819 5:155291105-155291127 ACATGTCACAAAAGGGTAACTGG - Intergenic
1000222960 5:159231968-159231990 AAGGGTTTCTAAAGGGTACCAGG + Intergenic
1000572328 5:162930151-162930173 TCTTGTTTCTACAGGGGGACTGG + Intergenic
1000743754 5:165003769-165003791 ACGTTTTTCTAAATGATAACAGG - Intergenic
1002839997 6:897238-897260 CCTTGATTCTAAACGGTATCAGG - Intergenic
1003964339 6:11238766-11238788 AATTGTTTCTTAAGGGAAATTGG - Intronic
1005312026 6:24567902-24567924 ACTTGTTTCTAAGGGGAAATTGG - Intronic
1006776668 6:36598188-36598210 ACTTGTTTTTCAAGGATAAATGG + Intronic
1007826952 6:44607725-44607747 GCTTGTTTCTAAAGGGGAGGAGG + Intergenic
1008042695 6:46818666-46818688 ACTTATTTCTGAAGGGTATCAGG - Intronic
1008172275 6:48223094-48223116 CCTTCTTTCTAAAGGCTGACTGG + Intergenic
1009676486 6:66830122-66830144 ACTTATGTGGAAAGGGTAACTGG - Intergenic
1011774549 6:90714881-90714903 ACCTGTTTCTTTAGGGCAACAGG - Intergenic
1013574040 6:111462188-111462210 ACTTATTAATAAAGAGTAACTGG - Intronic
1016252611 6:142063512-142063534 ACTTGTTTTTAAATGTTAAATGG + Intronic
1018117916 6:160606038-160606060 CCCTGTTTCTCAAGGGTGACAGG + Intronic
1022431869 7:30332358-30332380 ATTTTTTTTTAAAAGGTAACAGG - Intronic
1023248773 7:38235293-38235315 ACTTTTTTCTAAATGGGAAATGG + Intergenic
1027534702 7:79383013-79383035 ACTTGTTTCTTAAAGATGACAGG + Intronic
1027736831 7:81942967-81942989 ACTTGATGCTAGAGGGTAAGAGG + Intergenic
1028663071 7:93305786-93305808 TATTGTTGCTAAAGGGTATCTGG + Intronic
1029009374 7:97242539-97242561 ACATTTTTCTCAAGGGTACCTGG + Intergenic
1032185305 7:129720000-129720022 GCTTGTTTCTAAAGGCAAGCGGG + Intronic
1032485942 7:132287684-132287706 ACGTGTTTCTACATGGTCACTGG - Intronic
1032504791 7:132426865-132426887 ACTTGTCTCTAAGGGGGAAAAGG + Intronic
1033264637 7:139874194-139874216 ACTTGTTTCAAGGGGCTAACAGG - Intronic
1034600621 7:152251287-152251309 AATTTTTTTTAAAAGGTAACTGG + Intronic
1037172833 8:15913894-15913916 ACGTGTGTCTAAAGGGGGACTGG + Intergenic
1041772919 8:61491848-61491870 ACTTTTATCTAAATGATAACAGG + Intronic
1042544541 8:69939518-69939540 AGTAGCTTCTAAAGGGTTACTGG - Intergenic
1042584978 8:70326223-70326245 ACTTAATTATAAAGGGTAAGAGG - Intronic
1050797657 9:9564353-9564375 ACTTGTTTCTAAAGGGTAACAGG - Intronic
1051937959 9:22467207-22467229 ATCTTTTTTTAAAGGGTAACAGG + Intergenic
1053479103 9:38402847-38402869 ACTTGTTTTAAAAGGATCACTGG + Intergenic
1060908063 9:127325869-127325891 ACATGTTTCAAAAGGACAACTGG - Intronic
1187273360 X:17798417-17798439 ACTTGCTTCTAAAGGGCAAATGG + Intergenic
1198322107 X:135528324-135528346 AATTGTTTCTAATGGGAAATGGG + Intronic
1199825123 X:151490958-151490980 ACTTGTTTCTCAACTGTAACTGG - Intergenic
1202029262 Y:20554580-20554602 ACTTTCTTCTGAAGGGAAACTGG - Intergenic
1202141024 Y:21722502-21722524 ACTTCTTTCTTAAGATTAACTGG - Intergenic
1202145841 Y:21781296-21781318 ACTTCTTTCTTAAGATTAACTGG + Intergenic