ID: 1050802306

View in Genome Browser
Species Human (GRCh38)
Location 9:9630407-9630429
Sequence GTGTAGGAAAAGTGGGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050802306_1050802314 24 Left 1050802306 9:9630407-9630429 CCAATGTCCCACTTTTCCTACAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1050802314 9:9630454-9630476 ACAGCACTAGCCTGAAGTGACGG No data
1050802306_1050802317 30 Left 1050802306 9:9630407-9630429 CCAATGTCCCACTTTTCCTACAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1050802317 9:9630460-9630482 CTAGCCTGAAGTGACGGAAGGGG No data
1050802306_1050802315 28 Left 1050802306 9:9630407-9630429 CCAATGTCCCACTTTTCCTACAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1050802315 9:9630458-9630480 CACTAGCCTGAAGTGACGGAAGG No data
1050802306_1050802316 29 Left 1050802306 9:9630407-9630429 CCAATGTCCCACTTTTCCTACAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1050802316 9:9630459-9630481 ACTAGCCTGAAGTGACGGAAGGG No data
1050802306_1050802311 0 Left 1050802306 9:9630407-9630429 CCAATGTCCCACTTTTCCTACAC 0: 1
1: 0
2: 0
3: 12
4: 196
Right 1050802311 9:9630430-9630452 CTTCTACTTCGAGTCCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050802306 Original CRISPR GTGTAGGAAAAGTGGGACAT TGG (reversed) Intronic
900906782 1:5564844-5564866 CTGTAGGAAAAGAGAGAAATTGG - Intergenic
904155554 1:28479934-28479956 GTAGAGGAAAGGTGGCACATGGG + Intronic
904764310 1:32831331-32831353 GTTTGGGAAAAGTGGAAGATGGG + Intronic
905011758 1:34751825-34751847 GAGTGGGAAAAGTGGTGCATAGG + Intronic
907495477 1:54841390-54841412 GTGGAGGGAAAGTGGGACTGAGG + Intronic
908038658 1:60083807-60083829 GTGTATGTCAAGTGTGACATAGG + Intergenic
908385127 1:63634147-63634169 GGCTAGGAAAAGTGGGAATTGGG - Intronic
908883257 1:68758092-68758114 GTTTAGGAAAAATGGCAAATAGG + Intergenic
910718200 1:90255955-90255977 GTGAAGGAAATGTGGCATATTGG - Intergenic
910744633 1:90560230-90560252 TTGTAGGGAAAGTGGGATGTTGG + Intergenic
910832753 1:91477004-91477026 GTGTAGTCAAGGTGGGGCATAGG - Intergenic
911421945 1:97653689-97653711 GAGAAGGAAAAGGGGGACACTGG - Intronic
913551452 1:119920659-119920681 GGGTAGGAAAAGTGAGAATTGGG - Intronic
914369052 1:147006250-147006272 GTGTAGGAAAAGAGGAACTAGGG + Intergenic
914681670 1:149943392-149943414 GTGGAGGGGAAGTGGGAAATTGG - Exonic
916942877 1:169694698-169694720 GTGAAGGAGAAGTGGGGCAGGGG - Intronic
918367395 1:183822845-183822867 GAGTTGCAAAAGTGAGACATAGG - Intronic
918374319 1:183893643-183893665 ATGAAGGATAAGTAGGACATAGG - Intronic
919197367 1:194304232-194304254 GTGTAGAAAAAGTGGGTAGTAGG + Intergenic
920354529 1:205360904-205360926 TTCTAGGATCAGTGGGACATGGG - Intergenic
921477260 1:215627206-215627228 GTGAAGGAAAAGTGAGAACTTGG + Intronic
922139211 1:222865278-222865300 GAGTAGGAAAAGTTGGAAAAGGG + Intergenic
923540697 1:234886139-234886161 GGGCAGGCTAAGTGGGACATAGG + Intergenic
1063422596 10:5925225-5925247 TTGTAGGAAAAGGGGGAAAGAGG - Intronic
1063758154 10:9039796-9039818 CTGTTGGAAAATGGGGACATTGG - Intergenic
1065991449 10:31013859-31013881 GTGAAGGAAAAGAGGCAAATAGG - Intronic
1069698851 10:70407501-70407523 GTGTAGAAAGAGGTGGACATGGG - Intronic
1069940545 10:71952360-71952382 GTGTAGGAATAGGGGGAGAGCGG + Intergenic
1071321961 10:84470047-84470069 ATATAAGAAAACTGGGACATAGG - Intronic
1073340653 10:102741990-102742012 GTGTTGGAAAAATGGGAAACAGG - Exonic
1075872336 10:125779888-125779910 GTGGGGGAAAGGTGGGACCTGGG + Intergenic
1076040083 10:127238980-127239002 GTGTGGGGAAAGTGAGACAAGGG + Intronic
1076365196 10:129917066-129917088 ATGTATTAAAAGTGGGACACAGG + Intronic
1077146730 11:1049873-1049895 CTGTAGGAAAATGGGGACGTCGG + Intergenic
1077926167 11:6683554-6683576 GTGTGGGATAAGCGGGCCATCGG + Intergenic
1078405780 11:11068702-11068724 GTGTAGGGAGCATGGGACATGGG + Intergenic
1079645597 11:22860702-22860724 GGGTAGAAAAGGTGGGAAATTGG - Intergenic
1080937510 11:36879941-36879963 GTGTGGGAAAAGTGGAGCAATGG + Intergenic
1081459976 11:43263468-43263490 GTGGGGGAAATGTGGGACACAGG + Intergenic
1082972931 11:59042815-59042837 GTGAAGGAACAGTGGGAGGTTGG + Intronic
1082977335 11:59086385-59086407 GTGAAGGAACAGTGGGAGGTTGG + Intergenic
1084713946 11:70861933-70861955 GTCTCGGAATAGTGGGACACAGG + Intronic
1087615797 11:100485896-100485918 TTGTAGGAAAAATGGCAGATAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091158232 11:133393981-133394003 GTGTAGGAAAGGTGGGGGAATGG - Intronic
1094030499 12:26006780-26006802 GTGTTGGAATAGTGGAACATGGG + Intronic
1094215347 12:27935052-27935074 GTGTGGGACAGGTGGGATATAGG + Intergenic
1094229085 12:28082355-28082377 GTGTAGGATGAGTGGGAAACAGG - Intergenic
1095777630 12:46026724-46026746 CTGTAGGAAAAGTGTTCCATAGG - Intergenic
1097070132 12:56348670-56348692 GTGTAGGGAAGGAGGGACGTGGG + Intronic
1097759986 12:63452395-63452417 GGGTAGGAATAGAGGGAAATGGG + Intergenic
1098467440 12:70803948-70803970 GTCTAGGATAAGAGGCACATAGG + Intronic
1099282829 12:80674404-80674426 GTTTAGGAAAAGTTGTCCATAGG - Intronic
1101830321 12:108251786-108251808 GTGAAAGAAAACTGGCACATTGG - Intergenic
1103182190 12:118923018-118923040 GAATAGGAAAAGGGGGAAATGGG - Intergenic
1106760508 13:32862937-32862959 GTGGAGACAAAGTGGGAGATTGG + Intergenic
1107549028 13:41457932-41457954 GTGGAGGGAAGGTGGGACATGGG - Intronic
1108343583 13:49521816-49521838 GAGTAGAAAAATTGGCACATGGG - Intronic
1111020980 13:82451382-82451404 GTGGAGGAAAAGCATGACATTGG + Intergenic
1111726432 13:92015446-92015468 TTGTAGGAGAAGAGGGACCTGGG - Intronic
1111950192 13:94703663-94703685 GCGTAGGAAAAGTGGGTGCTGGG - Intergenic
1113111577 13:106829321-106829343 GTGTAGCAAGAGTGGGACCATGG + Intergenic
1113567107 13:111325700-111325722 GTGGAGGGAAAATGGGACACCGG + Intronic
1115243192 14:31269720-31269742 GGGTTGGAAAAGGGGGGCATGGG - Intergenic
1116759286 14:48991231-48991253 TTGTTGGAAATGTGGAACATGGG + Intergenic
1117305379 14:54468619-54468641 GTGTCTTGAAAGTGGGACATGGG + Intergenic
1118335101 14:64846784-64846806 GTGAAGGATCAGTGGGACAAAGG - Intronic
1119682508 14:76603461-76603483 GTGTAGGAAAAATGGGATGTGGG + Intergenic
1121765588 14:96482782-96482804 GGGTAGGAAAATTTGGACTTGGG - Intronic
1124582367 15:30970081-30970103 GTGGATGAAAAGTAGGATATAGG + Intronic
1125566949 15:40683855-40683877 GTGTAGGAAGAGGTAGACATGGG + Intergenic
1126097186 15:45097988-45098010 AGGTAGGAAACGTGGGACCTGGG - Exonic
1126751834 15:51885675-51885697 GTGTAGAAAGAGGTGGACATAGG - Intronic
1129367129 15:75063142-75063164 GTGTGGGGACAGTGGGATATGGG - Intronic
1129892796 15:79082634-79082656 GTGGAGGAAGAGAGGGACAGAGG + Intronic
1131070909 15:89465241-89465263 GTGCAAGAAAACTGGGAAATGGG + Intergenic
1131212803 15:90511871-90511893 GGGAAGGAATAGTGGGGCATAGG + Intergenic
1135055154 16:19225955-19225977 GGGTAGGAAGAGTGGGAGGTGGG + Intronic
1138028399 16:53539867-53539889 GTGTAGAAAGAGGTGGACATGGG + Intergenic
1138483579 16:57320300-57320322 ATGTAGGAAAAGAAGGACAGGGG - Intergenic
1139089435 16:63627092-63627114 GTGTAGAATAAGGGAGACATGGG + Intergenic
1142629540 17:1215784-1215806 GTGTAGAAAGAGGTGGACATAGG + Intronic
1142908819 17:3069687-3069709 GTGTAGGAAAAATGGTGGATAGG + Intergenic
1142925748 17:3234556-3234578 GTGTAGGAAAAATGGTGGATAGG - Intergenic
1143231629 17:5360659-5360681 GTGTAGGCAAAGAGGGCCAAGGG - Intronic
1144596798 17:16576674-16576696 GTGAAGAAAAAGTGGGAGAGAGG + Intergenic
1150824065 17:68458887-68458909 GGGTATTAAAAGTGGGAAATGGG - Intergenic
1152236868 17:79143437-79143459 GTGGAGGAAAAGAGGGTCAGAGG - Intronic
1153390927 18:4558642-4558664 TTGTTTTAAAAGTGGGACATGGG - Intergenic
1154316674 18:13309754-13309776 GTGAAGGAAAGGTGGGAGAGAGG + Intronic
1155038854 18:22048028-22048050 GTACAGGAAAAGAAGGACATTGG - Intergenic
1156469335 18:37367622-37367644 GTGTAGGAACAGAGGAACAGAGG + Intronic
1156874635 18:41994082-41994104 GTGGATTAAAATTGGGACATTGG + Intronic
1156880202 18:42068603-42068625 ATGTGGGAAAAGTGGGAGGTGGG - Intronic
1159938161 18:74385036-74385058 TTGTAGGAAAAGTGAGATGTGGG - Intergenic
1162184608 19:8895123-8895145 GTGTAGGACAAGAAGGACAGAGG + Intronic
1164862113 19:31570040-31570062 GTCTAAGAAAAGTCAGACATGGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165327718 19:35123940-35123962 TTCCAGGAAAACTGGGACATAGG + Intronic
1165395421 19:35561094-35561116 GTGTGGGACATGAGGGACATGGG - Intronic
1166114813 19:40647754-40647776 GTGTAGGAAGAGGTAGACATGGG - Intergenic
1167582181 19:50351612-50351634 GTGGAGGAGAAGTGGGATCTTGG - Intronic
927001557 2:18800235-18800257 GTGTTGGGAATGTAGGACATGGG + Intergenic
928850965 2:35745532-35745554 GACTAGGAAAGGTGGGACAGTGG - Intergenic
930032588 2:47067639-47067661 GTGAAGGCAAAGTGGGACTCAGG - Intronic
930116782 2:47724969-47724991 TTGCAGGAATAGTGGGAGATAGG + Intronic
932253766 2:70266850-70266872 GTGTAGAAAGAGGTGGACATAGG - Intronic
934859126 2:97749365-97749387 GTGTGGGAAAGGAGGGAGATGGG + Intergenic
936158917 2:110069655-110069677 GGGTAGTAAGAGTGGGAAATGGG + Intergenic
936185743 2:110301677-110301699 GGGTAGTAAGAGTGGGAAATGGG - Intergenic
936901945 2:117491153-117491175 GTGTAGGCAAACTGGGGCCTTGG - Intergenic
940537577 2:154966009-154966031 GTGAAGTAAAAGTGGGATGTGGG - Intergenic
940973603 2:159920319-159920341 ATCTAGGGAAAGTGGGACACAGG + Intergenic
942525529 2:176848997-176849019 GGGTAGGAAGAGGGGGGCATGGG + Intergenic
944670908 2:201993765-201993787 ATCTAGGAAAAGTGGGAGAGAGG + Intergenic
1169552303 20:6713620-6713642 GTGTGGGAAAAGGGGGTCAGAGG + Intergenic
1173010174 20:39175238-39175260 GTGTGGGAAAAATAGGACCTTGG - Intergenic
1173754319 20:45501681-45501703 ATGGAGGAAAAGAGGGACCTGGG - Intergenic
1175693188 20:61081168-61081190 GTGAAGGAAAAATGACACATCGG + Intergenic
1176314621 21:5231070-5231092 GGGTATGAAAAGTAGTACATCGG + Intergenic
1177730361 21:25021255-25021277 GTGATGGAAATGTGGGCCATTGG - Intergenic
1179079386 21:38156715-38156737 TTTTAAGAAAACTGGGACATTGG + Intronic
1179269421 21:39839052-39839074 GTCTTGGAAAACTGGGACATTGG + Intergenic
1180909471 22:19438938-19438960 GTGTAGAAAAATTGGAACCTTGG - Intronic
1181792220 22:25277520-25277542 GTGTAGAAAGAGGTGGACATGGG - Intergenic
1182680772 22:32077903-32077925 CTGTAGGAAAAATGTAACATTGG + Intronic
1183284757 22:36954849-36954871 GTGCAGGGGAAGTGGGGCATGGG - Intergenic
1184047312 22:41979494-41979516 GGGCAGGAAAAATGGGGCATTGG + Intronic
949171623 3:1005709-1005731 CTATAGGAAAAGGGGGCCATAGG - Intergenic
950612039 3:14133040-14133062 GGGTTGAAAATGTGGGACATGGG + Intronic
950730535 3:14952785-14952807 GGGTAGCAATAGTGGGATATGGG - Intronic
952529932 3:34252971-34252993 GTGGAGGAAAAGTGGGTTTTGGG + Intergenic
952699177 3:36307485-36307507 GTGTATGGCAAGTGGGAAATTGG - Intergenic
954405282 3:50341963-50341985 GTGCTGGTAAAGTGGGACAGTGG + Intronic
955112495 3:55962844-55962866 GGGAAGGGAAAGTGGGACAGTGG - Intronic
955708258 3:61751605-61751627 ATGTTGGAAAAGTGTGACATGGG + Intronic
956081416 3:65560636-65560658 AGATAGGAAAAGAGGGACATAGG + Intronic
958150060 3:89680774-89680796 GTGTATTAACAGTGTGACATTGG + Intergenic
959881472 3:111448627-111448649 GTGCTGGAAAAGTGGCACAGGGG - Intronic
965242770 3:166225108-166225130 GTGAAGTAGAAGTGGGAAATAGG + Intergenic
966884723 3:184370648-184370670 GTGAAGGGAGAGAGGGACATGGG + Intronic
967920332 3:194609563-194609585 TTGGTGGAATAGTGGGACATGGG + Intronic
969208011 4:5663470-5663492 GTGTGGGTAAAGTGGAACAATGG + Intronic
978464008 4:108988013-108988035 GGGTAGGAAAAGAGGTACATGGG + Intronic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
985025436 4:185735137-185735159 AGGTAGGAAAAGAGGGTCATGGG + Intronic
986004010 5:3652525-3652547 GGGCAGGGAAAGTGGGAAATGGG + Intergenic
986409932 5:7467317-7467339 GTGTAGGAGAAGAGGGAGCTTGG - Intronic
987510663 5:18833985-18834007 GGTTAGAAAAAGTGGGAAATAGG - Intergenic
988306341 5:29498958-29498980 GTGTGGGAAAAGTGGCACAGGGG + Intergenic
990058066 5:51610763-51610785 CTGTAGTACAAGTGGAACATAGG + Intergenic
990880733 5:60534806-60534828 GGGTAGGAAAAGTGGGGGAGTGG - Intergenic
992231163 5:74665491-74665513 GTGTAGGAAAGCAGGGGCATGGG - Intronic
993105668 5:83597531-83597553 GTGTAATTAAAGTGGGAGATTGG + Intergenic
994400992 5:99278418-99278440 GTATAGGGAATGTGGGAGATAGG - Intergenic
998492831 5:142562192-142562214 GTGGAGGAAAAGACTGACATTGG - Intergenic
1001295109 5:170493779-170493801 GGGAAGGAAGAGTGGGGCATGGG - Intronic
1001449817 5:171815985-171816007 ATGTAGGAAATGTAGGACATTGG - Intergenic
1002258550 5:177978100-177978122 GTGCTGGAAAGATGGGACATGGG + Intergenic
1003199464 6:3945832-3945854 GTGTTTAAAAAGTGGGATATAGG - Intergenic
1005914475 6:30340705-30340727 GAGTAAGAAAAGTGAGACATAGG - Intronic
1005981059 6:30836867-30836889 CTTTATGAAAAGTGGGGCATGGG + Intergenic
1006077105 6:31540731-31540753 GTTTAGGGAAAGTGGGAACTGGG - Intronic
1006993582 6:38237007-38237029 GTGTAGGAAAAGTGTGTGTTTGG - Intronic
1010469925 6:76215498-76215520 GAGAAGGAAAAGAGGCACATGGG - Intergenic
1011144697 6:84200448-84200470 GTGTAGGAGAAATGGGACTTTGG - Intronic
1011153659 6:84303966-84303988 GTCAGGGAAAAGGGGGACATTGG + Intergenic
1015861967 6:137690838-137690860 GTGTAGGAAACATGGGATCTGGG - Intergenic
1015876671 6:137829391-137829413 GTATAGGGGAAGGGGGACATGGG - Intergenic
1016236402 6:141872592-141872614 GTGTAGGAAAATAGGAACTTGGG - Intergenic
1016314161 6:142768592-142768614 ATGATGGAAGAGTGGGACATAGG - Intronic
1017572816 6:155765360-155765382 GTGTAGGAGATGTTGGAGATTGG + Intergenic
1022212841 7:28228121-28228143 TTGTAGCAAAAGTGGTATATAGG - Intergenic
1022871368 7:34483280-34483302 GCTTAGGAAAAGAGGGACTTAGG - Intergenic
1023488007 7:40707660-40707682 GTTTAGGGAAAGTGGGTTATTGG - Intronic
1027931737 7:84545813-84545835 GTGTATGAAAACTAAGACATTGG - Intergenic
1028607299 7:92669018-92669040 TTGCTGGAAAAGTGAGACATTGG - Intronic
1028797110 7:94915709-94915731 GTGAAAGAAAGATGGGACATAGG - Intronic
1031995517 7:128227861-128227883 GTGTGGGATAAGAGGGACACAGG + Intergenic
1032285889 7:130538252-130538274 GTGTGGAAAAAGTGAGACATTGG + Intronic
1034477066 7:151291402-151291424 GTGGAGGAAAGGTGAGTCATGGG - Intergenic
1036667650 8:10758045-10758067 GTGTAGGAGAGGTGGTACATGGG - Intronic
1037460216 8:19101300-19101322 CTGCAGGAAAAGGGGGACAATGG + Intergenic
1040499421 8:47993792-47993814 ATGTATGAACAGCGGGACATAGG - Intergenic
1042004116 8:64161850-64161872 GTGAGGGAAAAGTGGGGGATGGG - Intergenic
1044870472 8:96614878-96614900 GTTTAGGAATAGTGGGAGCTAGG - Intergenic
1045242107 8:100411618-100411640 GAGGAGGAAAAGAGGGACAGAGG + Intergenic
1046134578 8:110010205-110010227 GTACAAGGAAAGTGGGACATTGG + Intergenic
1049165597 8:141123696-141123718 GAGTAGGAAAAGTGTGTCCTGGG + Intronic
1049339827 8:142106103-142106125 GTGCAGGGACAGAGGGACATAGG + Intergenic
1050407459 9:5324985-5325007 GTGTAGGAGAAGTGGGGTGTTGG + Intergenic
1050414456 9:5400937-5400959 GTGTAGGAGAAGTGGGGTGTTGG + Intronic
1050802306 9:9630407-9630429 GTGTAGGAAAAGTGGGACATTGG - Intronic
1052619767 9:30891354-30891376 ATGTAGATAAAGTGGGTCATGGG + Intergenic
1057290087 9:93800899-93800921 GTGTAGAAAAATTGGGACTATGG + Intergenic
1059151503 9:111953543-111953565 GTGAAGGAAAAGAGGAAAATGGG + Intergenic
1061531872 9:131220700-131220722 GTGTGGGGAAACTGGGACTTAGG + Intronic
1187419283 X:19121523-19121545 CCTTAGGAAAAGTGGGAGATTGG - Intronic
1187571600 X:20509308-20509330 GTGTAGGAGTACTGAGACATAGG + Intergenic
1189401050 X:40669090-40669112 ATGGAGGAAAACTGAGACATGGG - Intronic
1190415057 X:50172677-50172699 GGGTAGGGAAAATGGGACAGGGG + Intergenic
1190488954 X:50961680-50961702 TTGAAGGAAATGTGGAACATTGG - Intergenic
1191160983 X:57329694-57329716 ATGTAGGCAAAGTGGCACAAGGG + Intronic
1193036604 X:76957992-76958014 GTGTTGGCAAAGTGGTACAGGGG + Intergenic
1194416331 X:93616883-93616905 GGTTAGGAAAACCGGGACATTGG + Intergenic
1194427251 X:93754468-93754490 GAGTAGTAAAAGTGGCACCTAGG - Intergenic
1195501970 X:105612690-105612712 GTGCAGGAATTGTGAGACATTGG + Intronic
1197141459 X:123121917-123121939 GTGCAGGCAAAGTGGCACAAGGG - Intergenic
1202575619 Y:26321611-26321633 GAGTGGGGAGAGTGGGACATGGG - Intergenic