ID: 1050814262

View in Genome Browser
Species Human (GRCh38)
Location 9:9789279-9789301
Sequence GGGAACTTGCCTATAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050814262_1050814267 19 Left 1050814262 9:9789279-9789301 CCTTGGCCTATAGGCAAGTTCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1050814267 9:9789321-9789343 GTGCGTAACTATTCAAGCTTGGG No data
1050814262_1050814268 30 Left 1050814262 9:9789279-9789301 CCTTGGCCTATAGGCAAGTTCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1050814268 9:9789332-9789354 TTCAAGCTTGGGAAGTGCACTGG No data
1050814262_1050814266 18 Left 1050814262 9:9789279-9789301 CCTTGGCCTATAGGCAAGTTCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1050814266 9:9789320-9789342 AGTGCGTAACTATTCAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050814262 Original CRISPR GGGAACTTGCCTATAGGCCA AGG (reversed) Intronic
904777633 1:32920971-32920993 GGGAACATGCCCAGAGGGCATGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
905823717 1:41014084-41014106 GGGAACTTCCCTTCAGTCCAGGG + Intergenic
905934714 1:41814141-41814163 GGGACCTTGCTTTTAGGCCATGG + Intronic
910439891 1:87241134-87241156 GAGAACTTGTCTCTAAGCCACGG + Intergenic
911804958 1:102194499-102194521 GGGACCTTTCCTATATGCCTAGG - Intergenic
915102153 1:153508269-153508291 GGGAGCCTGCCTACAGGACAGGG + Intergenic
915123457 1:153647400-153647422 GGGAACTCTCCTATCAGCCAAGG + Intergenic
915311344 1:155007311-155007333 GGGAACCAGCCTAGAGGGCAGGG - Intronic
915752865 1:158228305-158228327 GGGGACTTCCCTCTAGCCCAGGG - Intergenic
919973987 1:202599122-202599144 GGGAACTCACCTAGAGACCATGG - Intronic
923134762 1:231108189-231108211 GGGACCTTGCCTACATGCTAAGG + Intergenic
1071992373 10:91112473-91112495 GGGAACTTTCCTCTAAGCCCTGG - Intergenic
1076623289 10:131806626-131806648 GGCAATTTGCCCACAGGCCAAGG + Intergenic
1080394452 11:31876951-31876973 GGGAACTTGCCTATGGTTCCAGG + Intronic
1080578739 11:33623808-33623830 GGGAAGTTGCCTATAGGGGAGGG - Intronic
1084551141 11:69842906-69842928 GGGCACTTGCAGATGGGCCAAGG + Intergenic
1085282150 11:75338178-75338200 GGGGACTTTCCCATAGGACATGG + Intronic
1088502808 11:110499536-110499558 GAGAATTTGCATATGGGCCAAGG + Intergenic
1089741970 11:120590734-120590756 GGGTCCTTGCCTCTAGGCCTTGG + Intronic
1103732073 12:123034346-123034368 GGCATCGTGCCTAGAGGCCAGGG + Intronic
1123794544 15:23758280-23758302 GGGAACATGCTTACAGCCCATGG + Intergenic
1125345107 15:38711364-38711386 GGTAACTTGCCTGTATGGCATGG + Intergenic
1126323234 15:47447463-47447485 GGGAGCTTGCCTATAGCTAAAGG + Intronic
1126841602 15:52722837-52722859 GGCAACCTGCCTATAGGGAATGG - Intergenic
1127223008 15:56900061-56900083 GTGGTCTGGCCTATAGGCCAGGG - Intronic
1128505849 15:68272121-68272143 GGGAAATGGCCTCAAGGCCAGGG + Intergenic
1131315304 15:91330465-91330487 GGGAACTTACAAATAGGCAAGGG - Intergenic
1131412417 15:92220916-92220938 GGGAACTTGCCCCTACTCCAAGG - Intergenic
1138774597 16:59706354-59706376 AGGAACTTGTCTCAAGGCCAGGG - Intergenic
1139633470 16:68244623-68244645 GGGAACTTGCAGATGGCCCATGG + Intergenic
1141463246 16:84190933-84190955 CGGAACTTCCCTCCAGGCCATGG + Intergenic
1142319254 16:89370475-89370497 GGGAATTTGCCTCAAGGCCCTGG - Intronic
1142675970 17:1513589-1513611 GGGAAGTAGCCTGGAGGCCAGGG - Intronic
1143585543 17:7848620-7848642 GGGAACTTGGCTAGAGGCGGTGG - Exonic
926633203 2:15156291-15156313 GGGAGCATTCCTATAGGGCAGGG + Intergenic
927178163 2:20424754-20424776 GGGAGCTTCCCTACAGGCCCTGG - Intergenic
929957595 2:46470572-46470594 GGGAAGTTCCCTAAAGGACAGGG + Intronic
930904121 2:56545677-56545699 TGGGACTTGCCTATAAGCCTAGG - Intergenic
931775014 2:65533029-65533051 AGAAACTTGCCAACAGGCCAGGG - Intergenic
933883242 2:86692776-86692798 TGGCACTTGCCTATAGTCCTAGG + Intronic
934928271 2:98397197-98397219 GGGAACTTCCCCATCAGCCAGGG - Exonic
941684469 2:168434327-168434349 GGGAACTTGGCCAAATGCCAGGG - Intergenic
1172666192 20:36601899-36601921 GAAAACTTACCTTTAGGCCAAGG + Intronic
1173237374 20:41259167-41259189 GGCAACTTGCCCAAAGTCCATGG - Intronic
1177233142 21:18349003-18349025 GGAAACTTGCCTAAATGGCAGGG + Intronic
1179383582 21:40921357-40921379 GGGAACTTCCCATGAGGCCACGG - Intergenic
1181167365 22:20990995-20991017 GGGAGCTTCCCTGGAGGCCACGG + Intronic
1185060491 22:48603928-48603950 GGGAATATGCCTCCAGGCCAGGG - Intronic
949186949 3:1203309-1203331 GGGATCTTGCCTACAGCCAAGGG - Intronic
949420476 3:3859919-3859941 GGCAAATTGCCTATTGGCTATGG + Intronic
953309821 3:41865599-41865621 TGGAACTTTCCGATGGGCCAAGG - Intronic
955053961 3:55439855-55439877 GCCTCCTTGCCTATAGGCCATGG + Intergenic
967295820 3:187963729-187963751 GGCAAATTGCTTATAAGCCATGG - Intergenic
967393291 3:188978679-188978701 GGGAACTTGTTTAAAGGGCACGG - Intronic
981689571 4:147492203-147492225 AGGAACTTGCAGACAGGCCAAGG - Intronic
984950214 4:185002509-185002531 GGGAGCTTTCCTCTAGGCCCGGG - Intergenic
989442303 5:41487454-41487476 TGGACATTGACTATAGGCCAGGG + Intronic
995483289 5:112614210-112614232 GGGAAACTGCCCATAGTCCATGG - Intergenic
1005272742 6:24183573-24183595 GGAAACTTGTCTCTGGGCCAAGG - Intronic
1008855528 6:56081786-56081808 GGGCCCTTGTCTACAGGCCAGGG - Intronic
1009815119 6:68723014-68723036 GTGAACTTGCCTGTTGGACATGG + Intronic
1011612354 6:89166112-89166134 GGGCACATGCCTATAGTCCCAGG - Intergenic
1013707181 6:112850500-112850522 TGGATTTTGCCTACAGGCCATGG + Intergenic
1018911937 6:168106326-168106348 TGGAACCTGCCTATGGCCCAGGG - Intergenic
1030031983 7:105377950-105377972 GGGGAGTTGCTTAGAGGCCAGGG - Intronic
1036640124 8:10578086-10578108 TGGCTCATGCCTATAGGCCAAGG + Intergenic
1037174765 8:15933527-15933549 TGGACCTTGCCTCTAGGCCAAGG - Intergenic
1037727578 8:21495814-21495836 GGGCACATGCCTATAGTCCCAGG - Intergenic
1038024825 8:23578962-23578984 AGGACCTGGCATATAGGCCAAGG + Intergenic
1046359518 8:113131869-113131891 GAGAACTTGCCTAGATGCAAGGG - Intronic
1047017644 8:120740570-120740592 TGGAACTGGCTTACAGGCCATGG + Intronic
1050814262 9:9789279-9789301 GGGAACTTGCCTATAGGCCAAGG - Intronic
1051931674 9:22393884-22393906 GGGAACCTGTATTTAGGCCAAGG - Intergenic
1055183196 9:73415606-73415628 GGGAATTTGCCTAGAGACCTGGG - Intergenic
1058636638 9:107044543-107044565 AGGAAGTGGCCTTTAGGCCAAGG + Intergenic
1062412118 9:136430855-136430877 GGGGACTTGCCACAAGGCCAAGG + Intronic
1195707294 X:107746958-107746980 GGTGTCTTGTCTATAGGCCAAGG - Intronic