ID: 1050822346

View in Genome Browser
Species Human (GRCh38)
Location 9:9895229-9895251
Sequence CTGGTAACAAACAGAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050822346_1050822350 26 Left 1050822346 9:9895229-9895251 CCAGGAATTCTGTTTGTTACCAG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1050822350 9:9895278-9895300 AATATAAAATACACCTTAGGTGG No data
1050822346_1050822347 -9 Left 1050822346 9:9895229-9895251 CCAGGAATTCTGTTTGTTACCAG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1050822347 9:9895243-9895265 TGTTACCAGTAAGAGAAAAAAGG No data
1050822346_1050822349 23 Left 1050822346 9:9895229-9895251 CCAGGAATTCTGTTTGTTACCAG 0: 1
1: 0
2: 0
3: 16
4: 187
Right 1050822349 9:9895275-9895297 TAAAATATAAAATACACCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050822346 Original CRISPR CTGGTAACAAACAGAATTCC TGG (reversed) Intronic
900857263 1:5196167-5196189 CTGGAAACCACCAGAATCCCTGG + Intergenic
902364497 1:15962655-15962677 CTGTGGACAAACAGAATACCGGG + Intronic
903086567 1:20865215-20865237 CTGGTAACACAGTGAATTTCCGG - Exonic
907001961 1:50869842-50869864 CTGGTAACAAAGAGACTTTAAGG - Intronic
907217624 1:52879054-52879076 CTGCTAAAAAATAGACTTCCTGG - Intronic
907895323 1:58683698-58683720 CCTGTATCACACAGAATTCCAGG + Intronic
908100950 1:60790489-60790511 CTGATAACAAAATGAGTTCCCGG - Intergenic
908442991 1:64173529-64173551 CTGGTTTCAAACAGAATGCTGGG + Intronic
909843079 1:80354824-80354846 CTGCTAACTTACATAATTCCAGG - Intergenic
912575485 1:110667523-110667545 TTGCTAGCAACCAGAATTCCAGG + Intergenic
917502735 1:175600008-175600030 CTGGAAACATGCAGAATGCCAGG - Intronic
917691510 1:177474657-177474679 CTGGTAACAGCCAGAATTGAGGG - Intergenic
917755778 1:178095930-178095952 CTGGTTATAAGAAGAATTCCTGG - Intronic
919570837 1:199244936-199244958 ATGGCAACAAATAGAATTCTAGG - Intergenic
920102487 1:203526043-203526065 ATGGGAAGAAACAGAATTCTTGG + Intergenic
920369575 1:205469674-205469696 CTGGTTACAAATGAAATTCCTGG - Intergenic
921185708 1:212667618-212667640 CTGGCAACAAGCTGAGTTCCTGG + Intergenic
923601547 1:235407594-235407616 CTTGTAATAAACTGAATTCTTGG + Intronic
1066270084 10:33813763-33813785 CTGGTAACCAACCCAGTTCCTGG + Intergenic
1067733411 10:48830365-48830387 CTGGTATCCAACAGAATTATGGG + Intronic
1068064790 10:52115839-52115861 CTGGTAAAATACAGGATACCTGG + Intronic
1068531762 10:58196998-58197020 CTCTTAAGAAACAGGATTCCAGG + Intronic
1070629287 10:78073203-78073225 GTTGCAACAAACATAATTCCAGG - Intergenic
1071746910 10:88431100-88431122 CTTCTAACAAAGAAAATTCCAGG - Intronic
1072233951 10:93437634-93437656 CTGGGGACAAACACGATTCCAGG + Intronic
1072819282 10:98540134-98540156 CTGGTAACTAAAAGAATGCTAGG + Intronic
1073191437 10:101653242-101653264 CTGCTAACAAAGTGTATTCCTGG + Intronic
1074131002 10:110575332-110575354 CTGAGAACAAACTGAATTGCTGG - Exonic
1075774434 10:124971123-124971145 CGAGTAACAAACAGAATTCAAGG - Intronic
1076035133 10:127193947-127193969 CTATTAAGAAACAGAATTACTGG - Intronic
1076770477 10:132660429-132660451 CTTTTAAAAAACAAAATTCCAGG + Intronic
1077838486 11:5946371-5946393 CTGGTACCTAACAGAATGCCAGG + Intergenic
1081314826 11:41619390-41619412 CTGGCATCCAACACAATTCCTGG + Intergenic
1081565376 11:44257710-44257732 TTGGAATCACACAGAATTCCTGG + Intergenic
1083068446 11:59950000-59950022 CTGATGACAAAGAGATTTCCGGG + Intergenic
1087469912 11:98560045-98560067 CTGATAACTAACAGATTTTCTGG + Intergenic
1090318172 11:125816504-125816526 CTGGTAATAAAGAGAATTCTGGG - Intergenic
1090502659 11:127276544-127276566 CTGGTCACACACAGATCTCCTGG + Intergenic
1090594116 11:128302601-128302623 CTGGTAACAAACATTAAGCCTGG - Intergenic
1091610072 12:1999504-1999526 CTGGTCTCAAACTGAACTCCTGG - Intronic
1092340181 12:7669037-7669059 CTGCTAACACACAGAATTGGGGG - Intergenic
1092959537 12:13582841-13582863 CTGGTAATTAACTAAATTCCAGG - Intronic
1093441029 12:19196416-19196438 AAGGTAACTAACATAATTCCTGG + Intronic
1094096609 12:26712320-26712342 ATGTTAACACACAGAATTCGTGG - Intronic
1098462041 12:70742690-70742712 CTGGAAAAAAACAGAATTCGAGG + Intronic
1098978718 12:76931815-76931837 CTGGTAACCAACTGCATACCTGG - Intergenic
1099246983 12:80203744-80203766 CTAGTAAGAAAAAGAAGTCCAGG - Intergenic
1100192186 12:92204542-92204564 TTGGTAGCAAAAAGAATTACTGG - Intergenic
1101451564 12:104784548-104784570 TTGGTAAGAAACTCAATTCCGGG + Intergenic
1104202081 12:126599402-126599424 CTGGTAGCATACTGATTTCCAGG + Intergenic
1106060331 13:26284632-26284654 CTGCCAACAAAAAAAATTCCAGG + Intronic
1107161533 13:37234657-37234679 ATGTTAAAAAACAGAAATCCTGG + Intergenic
1107307416 13:39037841-39037863 CTGGTAACAAAGAGCCTGCCGGG - Exonic
1109865503 13:68258571-68258593 ATGTTATGAAACAGAATTCCAGG - Intergenic
1110584793 13:77176404-77176426 TAGGTAACAAACAAAATTCATGG + Intronic
1110592025 13:77274572-77274594 CTGGTAACTTACAGAAACCCAGG + Intronic
1111825842 13:93266013-93266035 CTGGTAACAATCAGCTTTCCAGG - Intronic
1111927182 13:94476365-94476387 CTGGTAACAAAAAGAGTTTATGG + Intronic
1113521072 13:110941458-110941480 CTGGTGACTGACAGCATTCCTGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114593102 14:23886989-23887011 CTCCCAACAAACAGAATTCCAGG + Intergenic
1114942167 14:27626220-27626242 CAGGTAACAGACTGTATTCCAGG - Intergenic
1114970054 14:28015554-28015576 CTGTTAACATAAATAATTCCTGG - Intergenic
1115061886 14:29202046-29202068 TTGGAAACAAACTGAATTCTAGG + Intergenic
1115488158 14:33932826-33932848 TTGGTAGCAAACAGAATTGATGG + Intronic
1116484293 14:45428101-45428123 CTGGGAAAAATTAGAATTCCAGG - Intergenic
1118848337 14:69565207-69565229 CTGGTAATAAGCAGTAGTCCTGG - Intergenic
1121689294 14:95864633-95864655 CTGGTATTAGTCAGAATTCCTGG + Intergenic
1129246572 15:74282609-74282631 CATGTAACAAACATAATCCCAGG + Intronic
1131086875 15:89583357-89583379 CTGGTAACAAGCATCATTCTGGG - Intronic
1131734131 15:95314059-95314081 CTGGTCTCAAACTGAACTCCTGG + Intergenic
1133727510 16:8551152-8551174 CTGGTAAAAACCAGAATTCTAGG - Intergenic
1136281430 16:29213706-29213728 CTGGTAAAAGGCAGACTTCCAGG - Intergenic
1138833992 16:60411138-60411160 CTGGGAACAAAGACAATTCAAGG - Intergenic
1141173724 16:81706175-81706197 CTGGTCAAATACAGAATCCCGGG - Intronic
1141327287 16:83073244-83073266 CTAGTAAGAAACAGAGTTCGAGG + Intronic
1142085800 16:88179634-88179656 CTGGTAAAAGGCAGACTTCCAGG - Intergenic
1142870260 17:2815143-2815165 CTGGTAACACACAGGTTTCCTGG - Intronic
1148603848 17:48913651-48913673 CTTGTAAAAAACAGATTTCTGGG - Intronic
1152236305 17:79140812-79140834 TTGGCAAAAAAAAGAATTCCGGG - Intronic
1152476736 17:80523244-80523266 CTGGTAACAAACAGGACCTCAGG + Intergenic
1153924043 18:9817485-9817507 CTGGAAACGAAGAGAATGCCAGG - Intronic
1154404534 18:14077107-14077129 CTGGGAAAAAACAGATTTCATGG + Intronic
1156764931 18:40641292-40641314 CTGGTGCAAAACAGACTTCCAGG + Intergenic
1158479478 18:57807559-57807581 CTTGTAAAAAAAAAAATTCCAGG - Intergenic
1158508608 18:58069417-58069439 CTGATAACTAAAAGTATTCCAGG + Intronic
1160063585 18:75553610-75553632 CAGGTAAGAAACAGTATTCAAGG - Intergenic
1160389812 18:78521604-78521626 CCGGTAACAAACAGAGCTCCTGG + Intergenic
1161418064 19:4159029-4159051 CTGTTATCACACAGAATTACAGG - Intronic
1161726508 19:5932432-5932454 CTGGTAAGAAACAGCAGCCCTGG - Exonic
1165250740 19:34531819-34531841 CTGGTTAGAAACAGAACTCGAGG - Intergenic
925809881 2:7689080-7689102 CTAGAAACAAACAGACTTCATGG - Intergenic
926179626 2:10630133-10630155 CTTGTAATGAACAGAATTCACGG - Intronic
927709713 2:25316865-25316887 CTGTTAACAAACATTATTCATGG - Intronic
932653693 2:73588033-73588055 CTGCTAACAAAAAAAAGTCCAGG + Intronic
933266569 2:80187207-80187229 CTGGCAGCAAACAGTATGCCTGG + Intronic
934097786 2:88623634-88623656 CTTGAAACAAACAGAATTACCGG + Intronic
934780063 2:96964316-96964338 GTGATAACACACAGAGTTCCTGG - Intronic
935044663 2:99469815-99469837 CTGGTGATAAACATAATTCTCGG - Intronic
936416476 2:112319199-112319221 TTGGTAAGAAAAAGTATTCCTGG + Intronic
938171569 2:129081894-129081916 CAGGTAACTAACAGAAATTCTGG + Intergenic
939130946 2:138235777-138235799 CTGGCAACAAAATAAATTCCTGG + Intergenic
939818376 2:146924246-146924268 CTGGTAAGAGACTGAATTCCTGG - Intergenic
942512301 2:176715420-176715442 CTGGTTAGAATCAGAGTTCCTGG + Intergenic
942848561 2:180455333-180455355 CAGGCAAGAAACAGACTTCCTGG - Intergenic
945882506 2:215340946-215340968 TTAGTAACAAACAGAAATGCTGG - Intronic
946281113 2:218666117-218666139 CTGGTCCCAAACAGAATGCCAGG + Intronic
946447097 2:219749335-219749357 TAAGTAACAAACAGCATTCCAGG + Intergenic
947157327 2:227175555-227175577 CTGATCACAAAGGGAATTCCTGG + Intronic
947629155 2:231640695-231640717 TTGGGCACAAACAGAATTGCAGG - Intergenic
947959014 2:234219040-234219062 CTGGTTACATTTAGAATTCCAGG + Intergenic
1168842962 20:921442-921464 CTAGAGCCAAACAGAATTCCTGG + Intergenic
1172157886 20:32841874-32841896 TTGGCAACAAACACCATTCCAGG - Intronic
1172358573 20:34296482-34296504 CTAGTAACAAAAAGTATTTCAGG + Intronic
1176305602 21:5121494-5121516 CTGGGAGCCAAGAGAATTCCAGG + Intronic
1177405581 21:20663348-20663370 CTCATAGCAAAGAGAATTCCAGG - Intergenic
1177707447 21:24725610-24725632 ATGCTACCAAACAGAATTGCTGG + Intergenic
1179851454 21:44140537-44140559 CTGGGAGCCAAGAGAATTCCAGG - Intronic
1184779607 22:46640497-46640519 CTGGTCACAAACAGAGCTGCTGG + Intronic
950618504 3:14182143-14182165 CTGGCAACACAGAGAACTCCTGG - Intronic
951294858 3:20921463-20921485 CTGGGAACAAAGAGAAAGCCCGG - Intergenic
955261051 3:57390892-57390914 CTGGTATAAAACCAAATTCCTGG + Intronic
956733287 3:72216426-72216448 CTAGTAAAACACAAAATTCCTGG + Intergenic
957333073 3:78791111-78791133 GTGAGAACAAAGAGAATTCCTGG + Intronic
957771513 3:84698649-84698671 CTGGTAATAAAAAGGAATCCAGG + Intergenic
957888554 3:86324353-86324375 CTACTAGCAAACTGAATTCCAGG + Intergenic
959113388 3:102148328-102148350 CTGGCAAAAAAGAGAATTTCAGG - Intronic
960803990 3:121565095-121565117 CTGGTAACAAGCACTATTCTGGG - Intergenic
961159115 3:124706962-124706984 CTGATTACAACCAGAATCCCTGG + Intronic
961430929 3:126882411-126882433 CTACTAAGAAACAGAAGTCCTGG + Intronic
962101907 3:132351530-132351552 CTGATAATAAACAAACTTCCTGG - Intronic
962592127 3:136901506-136901528 CTCCCAACAAACAGAAGTCCGGG - Intronic
964211477 3:154233129-154233151 CTGGTAAGAAACCCAATTCTAGG - Intronic
964950252 3:162282890-162282912 TTGAAATCAAACAGAATTCCAGG - Intergenic
966298827 3:178455815-178455837 TTAGTAACAAACAGAACCCCAGG - Intronic
966664730 3:182458548-182458570 CTCTTAACAAAGAGAAGTCCAGG - Intergenic
967131749 3:186477016-186477038 TTGGTTACAAACAGAGTCCCAGG - Intergenic
967376273 3:188805317-188805339 CTTCTAACAAAGAAAATTCCAGG - Intronic
970699925 4:18723945-18723967 CTGGTAACAAACAGTACTGGAGG + Intergenic
970983884 4:22132595-22132617 CTGGGAACAACAAGAATGCCTGG - Intergenic
971439303 4:26662770-26662792 TTGGTTACATATAGAATTCCAGG - Intronic
971915448 4:32865086-32865108 CTGGAAACAATCAGGATTCCTGG + Intergenic
972063789 4:34913018-34913040 CTGATAGAAAATAGAATTCCTGG - Intergenic
974323937 4:60389660-60389682 CTGGTTACAAACAAATTTTCTGG + Intergenic
974748688 4:66109086-66109108 ATGGAAACAAACAGAACTGCAGG - Intergenic
975114883 4:70669139-70669161 TTGGTAACACTCAGAATTTCTGG + Intronic
975567871 4:75778898-75778920 CTGGTAAAAAACATATTCCCTGG - Intronic
975613741 4:76226016-76226038 CTGCCAACAAAAAGAAGTCCAGG - Intronic
981890693 4:149732903-149732925 CTGCTCAAAAACAGAATTCAGGG + Intergenic
982859535 4:160431618-160431640 CTACTAACTAACAAAATTCCAGG - Intergenic
987265345 5:16247544-16247566 CTGGAAACAAACAAAATTTAAGG - Intergenic
988127949 5:27067051-27067073 CTGGTAAACAACAAAATTCCTGG - Intronic
988660832 5:33266415-33266437 CTGGTAAGAGACAGAATTGTAGG + Intergenic
988927670 5:36005816-36005838 CTGGTTACAGAGAGAAGTCCTGG + Intergenic
991423771 5:66469142-66469164 TTGGTAACAAACAGATTTTATGG - Intergenic
991702788 5:69331751-69331773 CTGAGAAGAAACAGCATTCCTGG - Intronic
992851578 5:80815171-80815193 ATGGCATCAAACAGAATTCAGGG - Intronic
995172262 5:109129193-109129215 CTTATAACAAAATGAATTCCGGG + Intronic
998792791 5:145783510-145783532 CTGTTAAAAATCAGAATTCTTGG + Intronic
1000417807 5:161001985-161002007 CTCCTAACAAAGAAAATTCCAGG - Intergenic
1000670031 5:164049934-164049956 CTTGTAAAAAACACAATTCTTGG - Intergenic
1001851492 5:174970783-174970805 CTGGGCACTAACTGAATTCCTGG + Intergenic
1002758279 6:181582-181604 TTGGTATCAGACAGAATTTCAGG + Intergenic
1004334172 6:14749158-14749180 CTGGAAAAAAACAGTATTTCAGG - Intergenic
1005049381 6:21669773-21669795 TTGGTAACAAACAGAAGCCCAGG - Intergenic
1005817530 6:29567519-29567541 CTGGCATCATACAGTATTCCAGG - Intronic
1006761354 6:36464644-36464666 CTGGTGACACCCAGAATTTCTGG - Intronic
1008041779 6:46809277-46809299 TTGGTAATAAATAGATTTCCTGG - Intronic
1016984664 6:149886041-149886063 CAGGTAAGAAAGAAAATTCCAGG + Intronic
1020749791 7:12125900-12125922 CTGGGAACTGATAGAATTCCAGG + Intergenic
1027130356 7:75586112-75586134 CTGTTAATAAAAACAATTCCTGG - Intronic
1027949779 7:84800334-84800356 TTGGTAAAAATTAGAATTCCTGG + Intergenic
1033630804 7:143155652-143155674 CTGGTCATAAACAGGATACCTGG - Intergenic
1033840191 7:145363655-145363677 CTGTAAACAAAGAAAATTCCAGG + Intergenic
1033948886 7:146759256-146759278 CTGGTGAAATACAGAATTCTTGG + Intronic
1039030083 8:33299460-33299482 CTGGAAACAAACAGTACTGCTGG + Intergenic
1039766619 8:40635121-40635143 CTGGTAAACAACAGTGTTCCAGG + Intronic
1040519239 8:48160656-48160678 CTGGGAACAAACAGGGTCCCAGG + Intergenic
1041518119 8:58725301-58725323 ATGGAAAGAAACAGAATTACAGG + Intergenic
1042159917 8:65882211-65882233 CTGGTACCAACCAGAAGCCCAGG - Intergenic
1046840064 8:118846546-118846568 CTGGTTACAAAAAGACTTGCTGG - Intergenic
1048155960 8:131951971-131951993 CTGTTACCAAATAGAACTCCAGG + Intronic
1049557205 8:143289094-143289116 CCCTTAGCAAACAGAATTCCAGG + Intergenic
1049960839 9:736491-736513 CTGGTCTCAAACTGAACTCCTGG - Intronic
1050822346 9:9895229-9895251 CTGGTAACAAACAGAATTCCTGG - Intronic
1051317955 9:15863470-15863492 TTTGTCACAAACAGAATTCTTGG + Intronic
1051724554 9:20075650-20075672 ATGCTAACAAACAGAGATCCTGG - Intergenic
1053142107 9:35688903-35688925 CTGGAACCAAACAGAATTACAGG + Intronic
1055574895 9:77650883-77650905 CTGGTAAGAAACAGAAAACTGGG + Intergenic
1056110807 9:83392599-83392621 CTGGTAACATCCAGCATGCCAGG - Intronic
1058694655 9:107549003-107549025 ATGTTCACAAACACAATTCCAGG + Intergenic
1058821784 9:108738480-108738502 CTGCTAACAAAGAAAACTCCAGG + Intergenic
1185781072 X:2847386-2847408 CATATAACAAAAAGAATTCCAGG + Intronic
1186314506 X:8354603-8354625 CTTGTGAAACACAGAATTCCTGG + Intergenic
1187638061 X:21254843-21254865 TTGGTAACACATTGAATTCCAGG - Intergenic
1189159872 X:38801063-38801085 CTGGAGGCAAACTGAATTCCGGG + Intergenic
1192901042 X:75497347-75497369 ATGCTAACAAAAAGAAATCCAGG + Intronic
1193398008 X:81008736-81008758 CTGTCAACAAAAAGAACTCCAGG - Intergenic
1193572306 X:83159741-83159763 ATAGTAACAAACAGAAGTCTGGG + Intergenic
1196114715 X:111986367-111986389 CTGTCAACAGACAGAAATCCAGG - Intronic
1196283705 X:113854893-113854915 CTGGAAACAAAAAGAATTTTAGG + Intergenic
1198257315 X:134935411-134935433 ATTCTAACAAAAAGAATTCCTGG - Intergenic
1200554546 Y:4619596-4619618 CTGGCAACCAAAAGAAGTCCTGG + Intergenic
1202098666 Y:21281871-21281893 CTGGAAAGATGCAGAATTCCTGG + Intergenic