ID: 1050838903

View in Genome Browser
Species Human (GRCh38)
Location 9:10121819-10121841
Sequence CCCTCCAACCATGAGGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050838895_1050838903 26 Left 1050838895 9:10121770-10121792 CCCTTTGTAGGTACCATCCTGTT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data
1050838897_1050838903 13 Left 1050838897 9:10121783-10121805 CCATCCTGTTTCCAGAGTGAATT 0: 1
1: 0
2: 4
3: 16
4: 265
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data
1050838896_1050838903 25 Left 1050838896 9:10121771-10121793 CCTTTGTAGGTACCATCCTGTTT 0: 1
1: 0
2: 1
3: 19
4: 134
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data
1050838898_1050838903 9 Left 1050838898 9:10121787-10121809 CCTGTTTCCAGAGTGAATTCCAA 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data
1050838899_1050838903 2 Left 1050838899 9:10121794-10121816 CCAGAGTGAATTCCAAGATTTTT 0: 1
1: 0
2: 3
3: 28
4: 260
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data
1050838900_1050838903 -10 Left 1050838900 9:10121806-10121828 CCAAGATTTTTTTCCCTCCAACC 0: 1
1: 0
2: 2
3: 40
4: 319
Right 1050838903 9:10121819-10121841 CCCTCCAACCATGAGGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050838903 Original CRISPR CCCTCCAACCATGAGGATTG AGG Intronic
No off target data available for this crispr