ID: 1050839868

View in Genome Browser
Species Human (GRCh38)
Location 9:10134867-10134889
Sequence CAGCAGCTCAACCACTGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050839866_1050839868 -5 Left 1050839866 9:10134849-10134871 CCTATTATATTAGATCCACAGCA 0: 1
1: 0
2: 1
3: 12
4: 137
Right 1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG No data
1050839864_1050839868 4 Left 1050839864 9:10134840-10134862 CCATGGCTCCCTATTATATTAGA 0: 1
1: 0
2: 0
3: 6
4: 127
Right 1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG No data
1050839865_1050839868 -4 Left 1050839865 9:10134848-10134870 CCCTATTATATTAGATCCACAGC 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG No data
1050839863_1050839868 18 Left 1050839863 9:10134826-10134848 CCTTCAGACAATCACCATGGCTC 0: 1
1: 0
2: 4
3: 7
4: 174
Right 1050839868 9:10134867-10134889 CAGCAGCTCAACCACTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050839868 Original CRISPR CAGCAGCTCAACCACTGAAA TGG Intronic
No off target data available for this crispr