ID: 1050841818

View in Genome Browser
Species Human (GRCh38)
Location 9:10158961-10158983
Sequence TGAACAGCCACTCTGACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050841818_1050841825 20 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841825 9:10159004-10159026 GTTTGTTCCACTGGTCCCCCTGG No data
1050841818_1050841821 -5 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data
1050841818_1050841822 -2 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841822 9:10158982-10159004 CAGCAGCACCATGTTGTAGGAGG No data
1050841818_1050841824 11 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841824 9:10158995-10159017 TTGTAGGAGGTTTGTTCCACTGG No data
1050841818_1050841826 21 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841826 9:10159005-10159027 TTTGTTCCACTGGTCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050841818 Original CRISPR TGAACAGCCACTCTGACTTG GGG (reversed) Intronic
900853728 1:5164124-5164146 TAAACAGCCACTGAGACCTGGGG - Intergenic
903376618 1:22870414-22870436 TGAACAGCCAGACTGACTCCTGG - Intronic
904233055 1:29093233-29093255 GTAACAGCCATTCTGACTGGTGG + Intronic
904322059 1:29704208-29704230 TGCACAGCCCCTCTGACCTCAGG + Intergenic
904562877 1:31410546-31410568 GGGATAGCCACTCTGACTTCAGG - Intronic
907249849 1:53130804-53130826 GGAACAGCCACTCTGGTGTGAGG - Intronic
907539262 1:55197415-55197437 TGAGCACCCACTCTGTCTTAGGG - Intronic
908367620 1:63442489-63442511 TTAACAGTCACACGGACTTGGGG + Intronic
915784405 1:158593642-158593664 ATAATAGCCACTCTGACTTTTGG - Intergenic
917787449 1:178473836-178473858 TGGACAGCTAATCTGATTTGGGG + Intronic
920838006 1:209529812-209529834 TGAGCAGCCTCTCTGGCTGGGGG - Intergenic
921148713 1:212383150-212383172 TGAACCAACACTCAGACTTGGGG + Intronic
921310736 1:213840727-213840749 TAAACAGCCACACTGACTCAGGG - Intergenic
921319322 1:213922997-213923019 GGAATCGCCACACTGACTTGTGG - Intergenic
922466789 1:225849888-225849910 TGAGCAGCCCTTCTGACCTGGGG - Intronic
924911944 1:248522629-248522651 TGAACCCTCACTCTGCCTTGAGG - Intergenic
1063176549 10:3555765-3555787 TGAACAGCCACACGTACTAGTGG - Intergenic
1063848441 10:10158788-10158810 TGTAAATCCACTCTCACTTGAGG + Intergenic
1064398150 10:14997883-14997905 TGAACACCCCCTGTGACCTGAGG - Intergenic
1064399655 10:15011176-15011198 TGTACACCCACTCTGACTTTAGG - Intergenic
1067068622 10:43117241-43117263 TGAACAGCCAGGCTGAATGGCGG + Intronic
1067303610 10:45037191-45037213 ATAACAGCCATTCTGACTGGTGG - Intergenic
1068645808 10:59466105-59466127 TAAACAGCCACTCTGAAATCTGG + Intergenic
1069753998 10:70762184-70762206 AGAACAGCCCCTTTGCCTTGGGG - Exonic
1074874389 10:117602818-117602840 TGGACACCCACACTGCCTTGGGG + Intergenic
1075185971 10:120257441-120257463 TTAATAGCCATTCTGACTGGTGG + Intergenic
1077583600 11:3433999-3434021 TGATCAGCCACGCAGGCTTGGGG + Intergenic
1077608578 11:3628792-3628814 TGCCCAGCCACTCTGTCTTCTGG - Intergenic
1077958426 11:7047018-7047040 TGAACAGCTACTATGCCCTGTGG - Intronic
1078344855 11:10538424-10538446 TGAACATGCACTCTGTGTTGTGG - Intronic
1078622365 11:12920908-12920930 TGAACAGCCACACTTTCTAGTGG - Intronic
1079040442 11:17054431-17054453 TGAACACCCCCTATGACATGAGG + Intergenic
1079702970 11:23572240-23572262 ATAATAGCCACTCTGACTGGTGG + Intergenic
1079751151 11:24199497-24199519 TGAAAAGGCAATCTGACATGAGG + Intergenic
1079889592 11:26034262-26034284 ATAATAGCCACTCTGACTGGTGG + Intergenic
1080212496 11:29802898-29802920 TTAATAGCCATTCTGACTGGTGG - Intergenic
1080876487 11:36279496-36279518 TGAACACCCACTCTCACTGGTGG - Intronic
1081818111 11:45964446-45964468 TGAACAGCCTCTCTGAATCATGG + Intronic
1082666481 11:55981867-55981889 TGCACACCCACTGTGACTTTAGG - Intergenic
1082936943 11:58664872-58664894 TGTACACCCACTGTGACTTTAGG + Intronic
1084227224 11:67724740-67724762 TGTACAGCCACTGTGATATGAGG - Intergenic
1084240520 11:67816799-67816821 TGATCAGCCACGCAGGCTTGGGG + Intergenic
1084812007 11:71617720-71617742 TGTACACCCACTCTGACTTTAGG + Intergenic
1084845085 11:71892128-71892150 TGTACACCCACTGTGACATGAGG + Intronic
1084977596 11:72811280-72811302 TGAACAATCACTCTGGCTTCTGG + Intergenic
1088194062 11:107256703-107256725 ATAAAAGCCACTCTGCCTTGTGG - Intergenic
1089116063 11:116096165-116096187 TGAAATGCCATTCTGACTTGTGG - Intergenic
1092410750 12:8251309-8251331 TGATCAGCCACTCAGGCTTGGGG + Intergenic
1092434920 12:8440191-8440213 TGTACACTCACTCTGACTTTAGG - Intergenic
1096508103 12:52109471-52109493 TGAACACCCCCTGTGACATGAGG + Intergenic
1097736249 12:63184319-63184341 ATAACAGCCATTCTGACTGGTGG + Intergenic
1099179799 12:79463594-79463616 TGAACACCCCCTCTGACATTAGG - Intergenic
1099800842 12:87454588-87454610 TGAACAGTCACTCTGATATGGGG - Intergenic
1105015082 12:132781746-132781768 TCCACAGCCTCTCTGAATTGAGG - Intronic
1105279892 13:18957400-18957422 TGAAGACCCACTCTAACTAGAGG - Intergenic
1107545498 13:41430023-41430045 TGAACACCCCCTGTGACCTGAGG - Intergenic
1108052746 13:46462354-46462376 TGAACACCCCCTGTGACCTGAGG + Intergenic
1108550897 13:51542699-51542721 AGAACAGCCACTCAGAATGGTGG - Intergenic
1109207872 13:59501588-59501610 TTAAGAGCTACTCTGAGTTGGGG + Intergenic
1109538551 13:63744038-63744060 TGAACACCCCCTGTGACCTGAGG + Intergenic
1109545285 13:63835731-63835753 TGAACACCCCCTGTGACCTGAGG - Intergenic
1110491519 13:76114790-76114812 TGAACAGCCACTCTCAGTAATGG + Intergenic
1111415104 13:87930005-87930027 TGATCAGCAACTCTGTTTTGGGG + Intergenic
1111778474 13:92692785-92692807 CCAAAAGCCACTCTGACTGGTGG + Intronic
1114401355 14:22413972-22413994 AGAACAGCCACTCTGAACTGCGG + Intergenic
1118540147 14:66814222-66814244 TGAACAATCACTCTTATTTGAGG + Intronic
1118575447 14:67237856-67237878 TGAACAGCCCTTCTGACAGGGGG + Intergenic
1119706734 14:76787787-76787809 CCAGCAGCCACTCTGACTTAGGG + Exonic
1120693502 14:87619204-87619226 TGACCAGCCAATCTGACTGAGGG - Intergenic
1122852920 14:104546577-104546599 TGAACTCCCTCTCTGATTTGGGG - Intronic
1123144842 14:106118880-106118902 GAAAGAGACACTCTGACTTGGGG + Intergenic
1123172176 14:106384092-106384114 TTAATAGCCATTCTGACTGGTGG + Intergenic
1123176682 14:106425886-106425908 ATAACAGCCATTCTGACTGGTGG + Intergenic
1202947031 14_KI270726v1_random:38056-38078 ATAACAGCCATTCTGACTGGTGG - Intergenic
1130424031 15:83777060-83777082 TGAGCAACCACTCCTACTTGTGG + Intronic
1130641329 15:85678511-85678533 TGAAAATCCACTCTAACTTTGGG + Intronic
1131620289 15:94060998-94061020 TGAACAGGGGCTCTGACTAGGGG + Intergenic
1137927342 16:52553114-52553136 TGTCCAGCCACCCTGACTTTTGG + Intergenic
1138294035 16:55871735-55871757 AGAGCAGCCACTCTGAGTTCTGG + Exonic
1139529657 16:67536932-67536954 TCAACAGCCACTCTTTTTTGGGG + Intronic
1141731841 16:85828262-85828284 AAAACAGCAACCCTGACTTGAGG - Intergenic
1147058012 17:37849189-37849211 TGAAAAGCCACTCACACTTGGGG - Intergenic
1148971590 17:51488023-51488045 TGAACAGTCACTGTGAATTCTGG + Intergenic
1148972801 17:51499114-51499136 TGAGAAGCCACTACGACTTGGGG - Intergenic
1150331470 17:64297761-64297783 TGAACACCCTCTCTGGCTGGAGG - Intergenic
1150837727 17:68579611-68579633 TGAAAAGCCACTCCGATTTCAGG - Intronic
1153476482 18:5504240-5504262 TGAACACTCACCCTGAGTTGGGG + Intronic
1154183057 18:12154405-12154427 ATAACAGCCATTCTGACTAGTGG - Intergenic
1161640730 19:5421059-5421081 TGAAAAAGCACTTTGACTTGTGG - Intergenic
1164477318 19:28585593-28585615 TGAGCAGCCTCTCTGCCTAGAGG - Intergenic
1164477602 19:28587203-28587225 GAAACAGCCACTTTCACTTGAGG + Intergenic
1164844982 19:31424466-31424488 TGAAGAGCCACTCAGGCTCGGGG - Intergenic
932230393 2:70079055-70079077 TGAATAGCAACTCTGAAATGGGG + Intergenic
932348968 2:71016604-71016626 TGTACAGCCCCTGTGACATGAGG + Intergenic
932350438 2:71026561-71026583 TGTACACCCACTCTGATTTTAGG + Intergenic
932351950 2:71039881-71039903 TGAACACCCCCTGTGACCTGAGG + Intergenic
932353946 2:71052829-71052851 TGTACACCCACTCTGACTTTAGG + Intergenic
932698914 2:73979966-73979988 TGTAAAGCCACTGTGATTTGGGG + Intergenic
934590331 2:95543807-95543829 TGTACACCCACTCTGACTTTAGG + Intergenic
939844271 2:147224320-147224342 TGTTCAGCCCCTCTGACTTCGGG + Intergenic
940869977 2:158851332-158851354 TGTACACCCACTCCGACTTTAGG + Intronic
940871515 2:158864491-158864513 TGAACACCCCCTGTGACCTGAGG + Intergenic
940872676 2:158872326-158872348 TGTACACCCACTCTGATTTTAGG + Intergenic
941047050 2:160688472-160688494 TGAAAAGGCACTATGATTTGAGG + Intergenic
941280054 2:163538557-163538579 AGAAGAGCCACACTGACTTCTGG - Intergenic
943341386 2:186686064-186686086 TAAACAGCCTCAGTGACTTGTGG + Intergenic
943529085 2:189056316-189056338 TGACTAGCCACTCTTACATGAGG + Intronic
944399237 2:199306182-199306204 GGCACAGCCTCTGTGACTTGGGG - Intronic
945961250 2:216137181-216137203 GGAAAAGCCACGCCGACTTGAGG - Exonic
946711255 2:222508969-222508991 TGAATAGCCACTCATACTTCTGG - Intronic
947742970 2:232493226-232493248 GGAACAGCCACTGTCACATGCGG + Intergenic
1170209677 20:13835992-13836014 TGAACAGGCAGTCAGTCTTGTGG + Intergenic
1170923625 20:20702504-20702526 TGAAGGGCCACTTTGGCTTGAGG - Intronic
1175920250 20:62447206-62447228 GGACCAGCCAGCCTGACTTGGGG - Intergenic
1177718504 21:24872651-24872673 GTAACAGTCACTCTGACTGGTGG + Intergenic
1178444125 21:32623177-32623199 TGAACACCCTCTGTGACATGAGG + Intergenic
1178467474 21:32860966-32860988 TGAACCTCCACTATGACTAGAGG - Intergenic
1179595958 21:42443443-42443465 TGAACAGCCCCTGGGGCTTGGGG + Intronic
1179671585 21:42953328-42953350 TGTACACCCACTCTGACTTTAGG - Intergenic
1181593484 22:23898367-23898389 TGAAAAACCACTCTGATATGAGG - Intronic
1184781199 22:46650518-46650540 TGAACGGCCACGCTGATTTGAGG - Intronic
1185319746 22:50195128-50195150 GGCACAGCCACACTGACTGGGGG - Intronic
949885056 3:8685904-8685926 TGTACACCCACTCGGACTTTAGG + Intronic
949886031 3:8694893-8694915 TGAACACCCCCTGTGACCTGAGG + Intronic
950608128 3:14102824-14102846 ATAACAGCCATTCTGACTGGTGG - Intergenic
956457694 3:69439701-69439723 TAAACAGGCACTCTGAGCTGTGG - Intronic
957055974 3:75443446-75443468 TGATCAGCCACTCAGGCTTGGGG + Intergenic
957276292 3:78094629-78094651 TGAAGAACCATTCTCACTTGTGG + Intergenic
959981953 3:112527488-112527510 TGTACACCCACTCTGACTTTAGG - Intergenic
961272719 3:125700996-125701018 TGTACACCCACTCTGACTTTAGG + Intergenic
961274211 3:125714288-125714310 TGAACACCCCCTGTGACCTGAGG + Intergenic
962358268 3:134713583-134713605 TGCACAGCCACTCTACCTGGGGG + Intronic
964807274 3:160624614-160624636 AGAAAAGCCACTCAGACATGGGG + Intergenic
968998782 4:3963729-3963751 TGATCAGCCACTCAGGCTTGGGG + Intergenic
969026019 4:4173081-4173103 TGAACACCCCCTGTGACCTGAGG - Intergenic
969734696 4:8979173-8979195 TGCACACCCACTCTGACTTTAGG + Intergenic
969825738 4:9757019-9757041 TGAACACCCCCTGTGACCTGAGG + Intergenic
972725065 4:41740176-41740198 TAAACAGCCACTCTGGAATGAGG + Intergenic
973105313 4:46328564-46328586 TCCACATCCACTTTGACTTGTGG + Intronic
979649741 4:123115299-123115321 TGAACAGTCACTCCGACGTGGGG + Intronic
980404508 4:132339169-132339191 ATAACAGCCATTCTGACTGGTGG + Intergenic
980405222 4:132345854-132345876 ATAACAGCCATTCTGACTGGTGG - Intergenic
981865109 4:149408024-149408046 ATAACAGCCATTCTGACTGGTGG + Intergenic
982944013 4:161595290-161595312 AGAACAGACACTCTGAATTCAGG + Intronic
985700804 5:1371241-1371263 TGAACACCCCCTCAGAATTGGGG - Intergenic
986264710 5:6181730-6181752 GGAACAGCCACCCTGACAGGAGG + Intergenic
987295762 5:16549707-16549729 TAAACAGCAGTTCTGACTTGAGG + Intronic
990174939 5:53097238-53097260 AGGACAGCCACACTGACTTTAGG - Intronic
991349077 5:65702006-65702028 TCAACAGCCACTGTGGCTAGTGG + Intronic
996004161 5:118401125-118401147 TCAATAGCCATTCTGACTGGTGG + Intergenic
997685739 5:135786663-135786685 TGAACACCCACTGTGACATTAGG - Intergenic
1001404348 5:171465233-171465255 TGAACATTTATTCTGACTTGTGG + Intergenic
1002129094 5:177068644-177068666 GGAAAAGGCACTCTGATTTGGGG + Intronic
1003618155 6:7673634-7673656 GGAACAGCCACCCTGACTGTGGG - Intergenic
1006786008 6:36667798-36667820 TGCACAGCCTGTCTGTCTTGGGG - Intergenic
1007473407 6:42104849-42104871 GGAACAACTACTCAGACTTGAGG - Exonic
1007982348 6:46171695-46171717 TGAACAGCCACCCTCTCTGGTGG + Intergenic
1014021079 6:116590691-116590713 TGAAAACCCAGTCTGCCTTGGGG - Intronic
1014285147 6:119488611-119488633 GGAATTGCCACACTGACTTGAGG - Intergenic
1015100775 6:129477166-129477188 TAAATAGCTACTGTGACTTGTGG - Intronic
1015262846 6:131258132-131258154 TTAACAGCAGCTCTGACTTAAGG - Intronic
1015359179 6:132317399-132317421 TGAACAGCCATCCTAACTTAAGG - Intronic
1019490876 7:1312649-1312671 TGGGCAGCCACTGAGACTTGGGG - Intergenic
1020306535 7:6840265-6840287 TGTACACCCACTCTGACTTTAGG - Intergenic
1020465585 7:8475049-8475071 TGGAGAGGCACTCTGACTGGGGG + Intronic
1022360460 7:29651602-29651624 TCAGCAGCCAGTCTGACTTAGGG - Intergenic
1023209873 7:37791850-37791872 TGTACAGCCACTGTGATATGAGG + Intronic
1024205336 7:47154647-47154669 TCAGCAGCATCTCTGACTTGAGG + Intergenic
1025756678 7:64351134-64351156 TGAACAATCACTCTTTCTTGGGG - Exonic
1026972460 7:74476703-74476725 TGAACAGCCACCCAGCCTTTGGG + Intronic
1027336533 7:77156789-77156811 TGGGCAGCCAATCTGACATGAGG - Intronic
1028497033 7:91473367-91473389 TGAACAGCTACTGTCACTTAGGG + Intergenic
1029079930 7:97964880-97964902 TGAACACCCTCTGTGACATGAGG - Intergenic
1029779258 7:102714320-102714342 TGGGCAGCCAATCTGACATGAGG + Intergenic
1031930004 7:127675344-127675366 TGAACAGCCACTGAGAATTTAGG - Intronic
1036378452 8:8220220-8220242 TGATCAGCCACTCAGGCTTGGGG - Intergenic
1036851120 8:12202423-12202445 TGATCAGCCACTCAGGCTTGGGG + Intergenic
1036872484 8:12444697-12444719 TGATCAGCCACTCAGGCTTGGGG + Intergenic
1036905528 8:12705950-12705972 TGTACACCCACTTTGACTTTAGG - Intergenic
1038827514 8:31020924-31020946 TGAACAGAAACTCTGAGCTGGGG + Intronic
1038967106 8:32586895-32586917 AGAAGAGCAACTTTGACTTGAGG + Intronic
1039221887 8:35340707-35340729 ACAACAGGCACTCTTACTTGAGG + Intronic
1042697324 8:71569438-71569460 TGAACAGCAACACTGAATTTTGG - Intronic
1043246654 8:78011680-78011702 TGAACAGCCACTAAAACTTTTGG + Intergenic
1043621926 8:82204410-82204432 TAAACATCCCCTCTGACTTCTGG - Intergenic
1047164996 8:122428259-122428281 TGAAAAGCAGCTCTGACTTAAGG + Intergenic
1049162543 8:141106423-141106445 TAAACAGCCTCTCAGACTGGAGG + Intergenic
1049771226 8:144382959-144382981 TGCACAGCCATTCTGACGTGTGG - Intronic
1050841818 9:10158961-10158983 TGAACAGCCACTCTGACTTGGGG - Intronic
1051249680 9:15146780-15146802 TGAACAGCAACACTGAGTTTGGG - Intergenic
1056866321 9:90229788-90229810 TGTACATCCACTCTGACTTTAGG + Intergenic
1057273025 9:93661168-93661190 TGAAGACCCACTCTGACTAGAGG + Intronic
1058889615 9:109349944-109349966 TGAAAAGCCACTGAGACTTGGGG - Intergenic
1060726779 9:126011417-126011439 TGAAAAGCCACTGACACTTGAGG + Intergenic
1189221882 X:39379179-39379201 TAAATGGCCACTCTCACTTGTGG - Intergenic
1192682234 X:73263886-73263908 CCAACAGCCCCTCTGCCTTGCGG + Intergenic
1192989262 X:76431215-76431237 TGAAAAGGCACTCTAAATTGTGG + Exonic
1196208249 X:112965732-112965754 TGGACAGCCACTCTAAACTGTGG - Intergenic
1197211657 X:123832991-123833013 TGAACAGAGACTCAGCCTTGTGG + Intergenic
1197981810 X:132225181-132225203 TGAACAGTCAGTCTTACTCGAGG - Intergenic
1199906092 X:152233005-152233027 ATAACAGCCATTCTGACTGGTGG + Intronic