ID: 1050841819

View in Genome Browser
Species Human (GRCh38)
Location 9:10158962-10158984
Sequence CTGAACAGCCACTCTGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 1, 2: 3, 3: 13, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050841819_1050841826 20 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841826 9:10159005-10159027 TTTGTTCCACTGGTCCCCCTGGG No data
1050841819_1050841822 -3 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841822 9:10158982-10159004 CAGCAGCACCATGTTGTAGGAGG No data
1050841819_1050841821 -6 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data
1050841819_1050841825 19 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841825 9:10159004-10159026 GTTTGTTCCACTGGTCCCCCTGG No data
1050841819_1050841824 10 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841824 9:10158995-10159017 TTGTAGGAGGTTTGTTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050841819 Original CRISPR CTGAACAGCCACTCTGACTT GGG (reversed) Intronic
905497305 1:38402983-38403005 CTGAACATACATTCTCACTTGGG + Intergenic
906910447 1:49943497-49943519 CTGAACACACACCCTGACTGGGG + Intronic
907539263 1:55197416-55197438 TTGAGCACCCACTCTGTCTTAGG - Intronic
913573111 1:120141419-120141441 CTGGGCAGGCACTCAGACTTGGG + Intergenic
914294367 1:146306216-146306238 CTGGGCAGGCACTCAGACTTGGG + Intergenic
914555411 1:148756999-148757021 CTGGGCAGGCACTCAGACTTGGG + Intergenic
916424070 1:164664036-164664058 CTGAGCAGCCACTTTGCATTTGG + Intronic
917068106 1:171119835-171119857 CTGAAAAACCACTCTAAATTAGG - Intergenic
920838007 1:209529813-209529835 CTGAGCAGCCTCTCTGGCTGGGG - Intergenic
921310737 1:213840728-213840750 ATAAACAGCCACACTGACTCAGG - Intergenic
921629760 1:217419123-217419145 GCAAGCAGCCACTCTGACTTTGG + Intergenic
1064488575 10:15824296-15824318 TTTAACAGCCATTCTGACTGGGG + Intronic
1065490153 10:26274686-26274708 CTGCACAGCCACTCTGGCCTGGG - Intronic
1069753999 10:70762185-70762207 CAGAACAGCCCCTTTGCCTTGGG - Exonic
1070874485 10:79789838-79789860 CTGACCAGCCTCTCTGAATATGG - Intergenic
1071641407 10:87311996-87312018 CTGACCAGCCTCTCTGAATATGG - Intergenic
1071737368 10:88316888-88316910 CTGAAAACACACTCTGATTTAGG - Intronic
1074262315 10:111866393-111866415 CTAAACAGAAACTCTGTCTTTGG + Intergenic
1079791823 11:24748320-24748342 CTGAACACACACCCTGACTGTGG - Intronic
1080684923 11:34507331-34507353 CAGAACAACCACTCTGAGATAGG + Intronic
1086866414 11:91985249-91985271 ATGAAGAGCCCCTGTGACTTTGG - Intergenic
1087419870 11:97908490-97908512 CTGAACAACCTCTCTAACTCGGG + Intergenic
1087441197 11:98185496-98185518 CTGGCCAGCCACTCTGAGTGCGG + Intergenic
1087819916 11:102700157-102700179 TTGAACATCCACTATGACTCAGG - Intronic
1092410749 12:8251308-8251330 ATGATCAGCCACTCAGGCTTGGG + Intergenic
1096517115 12:52162935-52162957 CTGAAAGCCCACACTGACTTTGG + Intergenic
1098500501 12:71186912-71186934 CTGAACACACACTCTTACTGGGG + Intronic
1099800843 12:87454589-87454611 TTGAACAGTCACTCTGATATGGG - Intergenic
1100698299 12:97119327-97119349 GAGATCACCCACTCTGACTTGGG + Intergenic
1102584064 12:113910932-113910954 CTGAACTGCCTCTCTGCCCTGGG + Intronic
1107044130 13:35977256-35977278 CTGCCCAGACACTCTGAGTTGGG - Intronic
1107281043 13:38735694-38735716 TTGAAAAGCCACTCTGTTTTAGG - Intronic
1109932552 13:69234952-69234974 CCCAAAACCCACTCTGACTTTGG - Intergenic
1110793557 13:79612064-79612086 CTGAACACACACTCTCACTGGGG - Intergenic
1114678505 14:24462053-24462075 CTGAGAAGCCAGTGTGACTTGGG - Intergenic
1116605667 14:46990987-46991009 CAGAACACACACTCTGAATTAGG + Intronic
1116953241 14:50897659-50897681 CTGTGGAGCCACTCAGACTTGGG + Intronic
1119706732 14:76787786-76787808 GCCAGCAGCCACTCTGACTTAGG + Exonic
1120693503 14:87619205-87619227 TTGACCAGCCAATCTGACTGAGG - Intergenic
1120842307 14:89096827-89096849 CCGCACAGCCAGTCTGCCTTGGG + Intergenic
1122852921 14:104546578-104546600 CTGAACTCCCTCTCTGATTTGGG - Intronic
1123015400 14:105371445-105371467 CTGAACAGCGTCTGTGACGTTGG - Intronic
1125707266 15:41749837-41749859 CAGAACAGCCACTTTTTCTTTGG - Exonic
1128444617 15:67747184-67747206 CTGTACAACCACCCTGAGTTTGG - Intronic
1130641328 15:85678510-85678532 GTGAAAATCCACTCTAACTTTGG + Intronic
1131620288 15:94060997-94061019 CTGAACAGGGGCTCTGACTAGGG + Intergenic
1132472257 16:111779-111801 AAGAACAGCCTCTCTGACTCAGG - Intronic
1133305244 16:4804283-4804305 CTGAAGAGCCACTCTTACCTCGG - Exonic
1133406019 16:5525155-5525177 CTGACAAGCCACTCTGCCCTGGG - Intergenic
1133749438 16:8713112-8713134 CAGAGCAGCCCCTCTGCCTTGGG + Exonic
1134264344 16:12680608-12680630 CTGCACAGCCCCTCTGATCTGGG + Intronic
1135189952 16:20346525-20346547 CTGACCAACCACTCAGTCTTGGG + Intronic
1135892575 16:26370820-26370842 CTGTACATTCACTCTGACCTGGG - Intergenic
1138801481 16:60035746-60035768 CTGAACAGCAACTCTAATTTTGG - Intergenic
1139529656 16:67536931-67536953 CTCAACAGCCACTCTTTTTTGGG + Intronic
1139744859 16:69066201-69066223 CTGCCCAGCCACTCTGCCTTTGG + Intronic
1140957539 16:79879494-79879516 ATGAAAAGTCACTCTGAATTTGG - Intergenic
1144278458 17:13699822-13699844 CTGAACACACACTCTCACTGGGG - Intergenic
1147058013 17:37849190-37849212 CTGAAAAGCCACTCACACTTGGG - Intergenic
1147188037 17:38723091-38723113 CTGCACAGCCACTCAGACCCTGG - Intronic
1150584755 17:66507398-66507420 CTGAACAGCAAAGCTAACTTAGG + Intronic
1151296332 17:73189102-73189124 CTGGATAGCCACTCCAACTTGGG + Intergenic
1153476481 18:5504239-5504261 CTGAACACTCACCCTGAGTTGGG + Intronic
1156338357 18:36188649-36188671 CAGAACAGCAACCATGACTTAGG + Intronic
1157160427 18:45308950-45308972 CTGAACAGGAACTCAGACTTAGG + Intronic
1159355991 18:67337935-67337957 CTGTGCAACTACTCTGACTTTGG + Intergenic
1160479639 18:79226941-79226963 CTGAACACCCACTGTGTGTTGGG + Intronic
1162320592 19:9968942-9968964 CTGATCACCCACGCTGACCTTGG - Intronic
1165247624 19:34506253-34506275 CTGAACAGCCCTTGTGACTATGG + Exonic
926907228 2:17816868-17816890 CTGGACAGACATCCTGACTTTGG - Exonic
928080501 2:28308304-28308326 CTGCAGAGCCACACTGTCTTGGG - Intronic
928400391 2:30973799-30973821 CTCAATAGCCACCCTCACTTTGG + Intronic
929822147 2:45282370-45282392 CTGAACAGCCACTAGGCCATAGG + Intergenic
932697557 2:73969391-73969413 CTGAGCAGCCTCTCTGACTCTGG + Intergenic
937022088 2:118666494-118666516 CTGAAAAGCCATTCTGAATCTGG + Intergenic
937426301 2:121801735-121801757 CTGAATGTCCACTCTCACTTTGG + Intergenic
939217609 2:139259961-139259983 CTGACCAGCCACTCTGAACTGGG + Intergenic
939675703 2:145069622-145069644 CTAAACAGCCCCTCTCACTGTGG - Intergenic
939844270 2:147224319-147224341 ATGTTCAGCCCCTCTGACTTCGG + Intergenic
940049704 2:149449193-149449215 GTGAACAGCCCTTTTGACTTTGG + Intronic
940341763 2:152588830-152588852 CTAAACAGCCAATGTGACTGGGG - Intronic
942976309 2:182022506-182022528 GTAAACAGCCACTCTGAGTTGGG - Intronic
944072323 2:195686066-195686088 CTCTAAAGCCACTCTGTCTTTGG - Intronic
944499693 2:200346469-200346491 GTTAACAGACACTCTGCCTTTGG - Intronic
947563602 2:231179199-231179221 CTGAAAAGGCATACTGACTTAGG - Intergenic
947767223 2:232645439-232645461 CTGAGCACCCACTGTGCCTTGGG + Intronic
1168811742 20:709323-709345 CTGTCCAGACACTCTGATTTTGG + Intergenic
1170946258 20:20893681-20893703 CTGAACACCCACTTTGAGTATGG - Intergenic
1170957030 20:20991038-20991060 CTTATAAGCCACTCTGTCTTCGG - Intergenic
1174138939 20:48399366-48399388 CTCAACAGCAACTCTGCCCTGGG + Intergenic
1174332625 20:49832052-49832074 CTGAAGAGCTGCTCTGACCTTGG + Intronic
1176187629 20:63789835-63789857 CTGAACGGCCACCCCGACGTCGG + Exonic
1179206436 21:39284606-39284628 GAGAACAGCCATTCTGACTGGGG + Intronic
1180240876 21:46504319-46504341 CTTAACAGCCACTTTCATTTTGG + Intronic
1180724572 22:17936824-17936846 CAGAAAAGCTTCTCTGACTTAGG - Intronic
1181763029 22:25070965-25070987 CTGCACAGCTTCCCTGACTTTGG - Intronic
1183602117 22:38845761-38845783 CAGCAGAGCCACTGTGACTTGGG + Intergenic
949496073 3:4633379-4633401 TTGGACAGCCACTTTGCCTTTGG + Intronic
950015538 3:9752253-9752275 CTGAACCCCAACTCTCACTTGGG + Intronic
950223139 3:11211990-11212012 CTAACCAGCTATTCTGACTTGGG - Intronic
954416461 3:50395775-50395797 CTGGACAGCCCCTCTAACTATGG - Intronic
957055973 3:75443445-75443467 ATGATCAGCCACTCAGGCTTGGG + Intergenic
959728978 3:109578789-109578811 ATTAATAGCCACTCTGACTGGGG + Intergenic
961910743 3:130313794-130313816 CTGAATAGCAACTCTAACTGAGG - Intergenic
962260939 3:133905493-133905515 CTGAGCTGCTACTCTGCCTTTGG - Intergenic
964025277 3:152065883-152065905 CTGAACTGTCAATCTGAATTAGG + Intergenic
964078836 3:152726334-152726356 CTGAAGAACCTCTTTGACTTTGG - Intergenic
964489224 3:157217226-157217248 TGGAACAACCTCTCTGACTTTGG - Intergenic
968998781 4:3963728-3963750 ATGATCAGCCACTCAGGCTTGGG + Intergenic
971255373 4:25009192-25009214 ATGATCAGCCTTTCTGACTTTGG + Intronic
972330376 4:38058496-38058518 CTGCATTCCCACTCTGACTTTGG + Intronic
975912444 4:79282984-79283006 CTCAAAAGCCTCTCTGAGTTTGG - Intronic
976204336 4:82610176-82610198 CTGAGCAGCCAGGCTGACCTTGG + Intergenic
976623633 4:87154985-87155007 CTTAATAGCCATTCTGACTGGGG - Intergenic
976963223 4:91003996-91004018 CTGAACACACACCCTGACTGGGG - Intronic
979649740 4:123115298-123115320 CTGAACAGTCACTCCGACGTGGG + Intronic
981398828 4:144287945-144287967 CTTAACAGTCACTTTGAATTGGG - Intergenic
982108166 4:152029340-152029362 GTGAACAACCAACCTGACTTTGG + Intergenic
985700805 5:1371242-1371264 CTGAACACCCCCTCAGAATTGGG - Intergenic
986349982 5:6868333-6868355 CTGCCCAGCCCCTCTGACCTTGG + Intergenic
987912165 5:24161862-24161884 CTGGCCTGCTACTCTGACTTCGG + Intronic
990645774 5:57842830-57842852 CCGAACATCCACTATGAGTTGGG + Intergenic
994051407 5:95366232-95366254 CTGAACACACACTCTCACTGGGG - Intergenic
1003618156 6:7673635-7673657 GGGAACAGCCACCCTGACTGTGG - Intergenic
1003623583 6:7723808-7723830 CTGAGCAGCAACTCTGATTCAGG - Intergenic
1005142453 6:22649005-22649027 CTGGACAGCCACTCTTCCTGAGG - Intergenic
1005280007 6:24262848-24262870 CTGAACAGCCCCTGGGCCTTGGG + Intronic
1007114647 6:39335048-39335070 CTGAACAGCGACTCTGTGCTTGG + Exonic
1010633825 6:78232050-78232072 CTGAACACACACTCTCACTGGGG - Intergenic
1012818144 6:104050725-104050747 CTGCACATGCACTCTGATTTGGG - Intergenic
1013470612 6:110460768-110460790 CCCCACAACCACTCTGACTTTGG + Intronic
1013856571 6:114580654-114580676 CTGAACACACACTCTCACTGGGG + Intergenic
1016917357 6:149257073-149257095 CTAACCAACCACTCTGACTGTGG - Intronic
1019481851 7:1270535-1270557 CTGAGCAGGCACTGTGACCTGGG - Intergenic
1019490877 7:1312650-1312672 CTGGGCAGCCACTGAGACTTGGG - Intergenic
1019665154 7:2248281-2248303 CTGAACACCCACTCTGTGCTGGG - Intronic
1019886629 7:3911344-3911366 CTGACAAGCCACTCTGTCTATGG - Intronic
1022360461 7:29651603-29651625 ATCAGCAGCCAGTCTGACTTAGG - Intergenic
1022957093 7:35390922-35390944 CTGGAGAGCCACACAGACTTTGG + Intergenic
1024506735 7:50168183-50168205 CGGAGCAGCAACTCTGACATAGG - Intergenic
1024603914 7:51009858-51009880 GTGAGCAGCCACTCGGCCTTTGG + Intergenic
1025756679 7:64351135-64351157 CTGAACAATCACTCTTTCTTGGG - Exonic
1026366416 7:69653095-69653117 CTGAAGTGACACTCTGACCTTGG + Intronic
1026972459 7:74476702-74476724 CTGAACAGCCACCCAGCCTTTGG + Intronic
1028497032 7:91473366-91473388 CTGAACAGCTACTGTCACTTAGG + Intergenic
1028702720 7:93800287-93800309 TTGAACTCCAACTCTGACTTAGG - Intronic
1030096179 7:105902147-105902169 CTGAAAACCCAGTGTGACTTGGG + Intronic
1031165880 7:118226111-118226133 CTCAACAGCAACTCTGAGTTTGG - Intronic
1036378453 8:8220221-8220243 ATGATCAGCCACTCAGGCTTGGG - Intergenic
1036851119 8:12202422-12202444 ATGATCAGCCACTCAGGCTTGGG + Intergenic
1036872483 8:12444696-12444718 ATGATCAGCCACTCAGGCTTGGG + Intergenic
1038827513 8:31020923-31020945 CTGAACAGAAACTCTGAGCTGGG + Intronic
1040392790 8:46963923-46963945 GGGAACAGCCCCTCTGCCTTTGG - Intergenic
1041609690 8:59830878-59830900 CTGAACAGCCACTCTGATTTGGG - Intergenic
1041955980 8:63558613-63558635 CCCAGCACCCACTCTGACTTCGG + Intergenic
1042877822 8:73455872-73455894 CTGAACATCCACTATGTTTTAGG - Intronic
1046437024 8:114204212-114204234 AATAACAGCCATTCTGACTTGGG - Intergenic
1048080116 8:131117781-131117803 CTCAACAGCCACTCTGATTTGGG + Intergenic
1050841819 9:10158962-10158984 CTGAACAGCCACTCTGACTTGGG - Intronic
1051207197 9:14700594-14700616 CTGAACAACCAGACTAACTTAGG + Intergenic
1051249681 9:15146781-15146803 GTGAACAGCAACACTGAGTTTGG - Intergenic
1056068369 9:82960555-82960577 TTGTACAGCCTGTCTGACTTGGG - Intergenic
1056547060 9:87621706-87621728 CTGAGGATCCACTCTGACTCTGG + Intronic
1058889616 9:109349945-109349967 GTGAAAAGCCACTGAGACTTGGG - Intergenic
1188077403 X:25795387-25795409 TGAAACAGCAACTCTGACTTCGG - Intergenic
1190893636 X:54594565-54594587 CTATTCAGCCACTCTGTCTTTGG + Intergenic
1192216532 X:69163230-69163252 CTGACCCATCACTCTGACTTAGG + Exonic
1192947474 X:75981875-75981897 CTGAACAGCCACTCTGAATGAGG + Intergenic
1193179913 X:78442372-78442394 GTGAACAGCCACTCTGAATTAGG + Intergenic
1196002779 X:110804613-110804635 CTAAACAGTCACTCTCACATTGG + Intergenic
1196765908 X:119242599-119242621 CTGAAAAGCCAGCCTGAGTTTGG - Intronic
1197284629 X:124581721-124581743 CATAGCAGCCATTCTGACTTAGG + Intronic
1198687869 X:139247106-139247128 CTGAGCAGACACTCAGACCTGGG - Intergenic