ID: 1050841820

View in Genome Browser
Species Human (GRCh38)
Location 9:10158963-10158985
Sequence GCTGAACAGCCACTCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050841820_1050841825 18 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC No data
Right 1050841825 9:10159004-10159026 GTTTGTTCCACTGGTCCCCCTGG No data
1050841820_1050841824 9 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC No data
Right 1050841824 9:10158995-10159017 TTGTAGGAGGTTTGTTCCACTGG No data
1050841820_1050841821 -7 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC No data
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data
1050841820_1050841826 19 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC No data
Right 1050841826 9:10159005-10159027 TTTGTTCCACTGGTCCCCCTGGG No data
1050841820_1050841822 -4 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC No data
Right 1050841822 9:10158982-10159004 CAGCAGCACCATGTTGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050841820 Original CRISPR GCTGAACAGCCACTCTGACT TGG (reversed) Intronic