ID: 1050841821

View in Genome Browser
Species Human (GRCh38)
Location 9:10158979-10159001
Sequence GTTCAGCAGCACCATGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050841820_1050841821 -7 Left 1050841820 9:10158963-10158985 CCAAGTCAGAGTGGCTGTTCAGC 0: 4
1: 25
2: 67
3: 67
4: 204
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data
1050841818_1050841821 -5 Left 1050841818 9:10158961-10158983 CCCCAAGTCAGAGTGGCTGTTCA 0: 1
1: 0
2: 0
3: 26
4: 174
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data
1050841819_1050841821 -6 Left 1050841819 9:10158962-10158984 CCCAAGTCAGAGTGGCTGTTCAG 0: 1
1: 1
2: 3
3: 13
4: 155
Right 1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050841821 Original CRISPR GTTCAGCAGCACCATGTTGT AGG Intronic
No off target data available for this crispr