ID: 1050845425

View in Genome Browser
Species Human (GRCh38)
Location 9:10211292-10211314
Sequence GGAAAAATAATGCATCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050845423_1050845425 21 Left 1050845423 9:10211248-10211270 CCTGAAGAGCACTTTGAAAGGAA 0: 1
1: 0
2: 1
3: 24
4: 255
Right 1050845425 9:10211292-10211314 GGAAAAATAATGCATCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050845425 Original CRISPR GGAAAAATAATGCATCTTCA AGG Intronic
No off target data available for this crispr