ID: 1050856685

View in Genome Browser
Species Human (GRCh38)
Location 9:10366192-10366214
Sequence CTGTATTTACAGATGGCATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050856685_1050856693 23 Left 1050856685 9:10366192-10366214 CCCTATGCCATCTGTAAATACAG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1050856693 9:10366238-10366260 TCTCTTTCTGGAAACCCAACTGG No data
1050856685_1050856691 11 Left 1050856685 9:10366192-10366214 CCCTATGCCATCTGTAAATACAG 0: 1
1: 0
2: 1
3: 16
4: 210
Right 1050856691 9:10366226-10366248 TTTATGCCATGATCTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050856685 Original CRISPR CTGTATTTACAGATGGCATA GGG (reversed) Intronic
903010160 1:20324169-20324191 CTGTTTTTCCAGATGGCCAAGGG - Intronic
903120221 1:21211442-21211464 CTATATTAACAGATGCCCTAAGG - Intergenic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903129157 1:21267106-21267128 CTGTGTCTTCACATGGCATATGG - Intronic
904197805 1:28798986-28799008 CTGTCTTAACAGATGGCAGCAGG - Intergenic
906841444 1:49143873-49143895 CTGGATTGAAAAATGGCATATGG - Intronic
907731160 1:57067346-57067368 CTTTATTTACAGAGGTCAGAGGG + Intronic
910217494 1:84857045-84857067 CTGCCTTGACAGATGGCAAATGG - Intronic
912177713 1:107180970-107180992 CTGTATTTAGAGATCCCCTAAGG + Intronic
912675675 1:111678983-111679005 CTGCATTTACTGATAGTATATGG - Intronic
913455580 1:119027145-119027167 CTGCATTTACAGATAGGAAATGG + Intergenic
913614359 1:120542524-120542546 CTGTACTAACTGATGGCACATGG + Intergenic
914575910 1:148968376-148968398 CTGTACTAACTGATGGCACATGG - Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
919602828 1:199643476-199643498 CTTTACTCACAGATGACATAAGG + Intergenic
920842848 1:209569215-209569237 TTGTCTTTCCAGATGGAATAGGG - Intergenic
921193014 1:212726449-212726471 CTGTTTATCAAGATGGCATATGG + Intronic
923775779 1:236977386-236977408 CTGCATCTTCAGATGGCAAAAGG + Intergenic
923979457 1:239304790-239304812 ATGTATTTGCAGATGGCTTAAGG + Intergenic
1063567978 10:7189106-7189128 CTATTTTTACAGATTTCATAAGG + Intronic
1063760518 10:9069664-9069686 CCTTATTTACAGATGTCATCAGG + Intergenic
1064153692 10:12886364-12886386 GGGTTTTTAAAGATGGCATAGGG + Intergenic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1065871379 10:29959139-29959161 CTGTATCTTCACATGGCAGAAGG - Intergenic
1069108196 10:64409702-64409724 CTATGTTTCCAGATGTCATATGG - Intergenic
1071197956 10:83183553-83183575 CTATATATACAGAATGCATAAGG + Intergenic
1071450201 10:85786704-85786726 CAGTAATTACAGATGGGAAAGGG + Intronic
1072181197 10:92982161-92982183 ATGAATTTACTGTTGGCATATGG + Intronic
1072605809 10:96981741-96981763 CTTTGTGTACAGCTGGCATAGGG - Exonic
1073419722 10:103414867-103414889 CTGTTATTCCAGATGGCACATGG - Intronic
1077213578 11:1384607-1384629 CTGTAGCTACAGAAGGCAGAGGG - Intergenic
1078466164 11:11552163-11552185 CTGCATTTCCAGAGGGCCTATGG - Intronic
1078974895 11:16462530-16462552 GTTTTTTTAAAGATGGCATAAGG + Intronic
1080014006 11:27486174-27486196 TTGTATTTACAGAAGGCAATGGG + Intergenic
1081506885 11:43727123-43727145 CTGTATACTCAGATAGCATATGG + Intronic
1081577961 11:44331281-44331303 CTTTATTTCCAGTTGGCATCAGG - Intergenic
1083062117 11:59884802-59884824 CTCTATTTAAAGATGACATGAGG - Intergenic
1085402881 11:76244993-76245015 CTGTGTTCTCACATGGCATAAGG - Intergenic
1085846457 11:80071395-80071417 CTGCATTTTCACATGGCAGAAGG - Intergenic
1086545057 11:87958038-87958060 CAGTTTTTACAGAATGCATATGG - Intergenic
1086778195 11:90866627-90866649 CTGTATCTAAAGAAGGCATCAGG + Intergenic
1087984614 11:104662154-104662176 CTGAAATCACAGATGTCATATGG - Intergenic
1089418918 11:118316325-118316347 CTCTCTTTAGAGAGGGCATAAGG + Intergenic
1091097512 11:132838021-132838043 ATTTGTTTACAGATTGCATACGG + Intronic
1091719224 12:2800522-2800544 CTGTAGTTTCAGATGACACATGG - Exonic
1093391739 12:18632217-18632239 CTGTATGTACTGATTGGATAAGG - Intronic
1095041981 12:37453513-37453535 CTGCATCTTCACATGGCATAAGG + Intergenic
1096635973 12:52959850-52959872 CTGGCTTTAAAGATGGCAGATGG - Intergenic
1097561625 12:61213881-61213903 CTGTATTTTCACATGGCAGAAGG + Intergenic
1098581215 12:72101582-72101604 TTGTATTTACAGATTTCAGATGG - Intronic
1099377894 12:81915625-81915647 TTGTATTTTCAGATGATATAAGG + Intergenic
1101646012 12:106631587-106631609 CTGTGTTCACACATGGCAGAAGG - Intronic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1103253265 12:119519248-119519270 CTGTATTTTCAGATGGCTAGGGG - Intronic
1105987446 13:25581672-25581694 TTGTGTCTACAGATGGCATCTGG - Intronic
1106964799 13:35049949-35049971 CTGTATTTGCTGATTGCAAATGG + Intronic
1107829871 13:44364946-44364968 TTGTATTTCCAGATGACATGAGG + Intergenic
1108085417 13:46785115-46785137 CTCAATTTAAGGATGGCATATGG - Intronic
1109878983 13:68446426-68446448 TTGTAATTAGAGATGTCATATGG + Intergenic
1110319348 13:74142709-74142731 CTATATTTACAGGTATCATAGGG - Intergenic
1110793006 13:79606093-79606115 CTCTTTTAACAAATGGCATATGG + Intergenic
1110882614 13:80590740-80590762 CTGGTTTTGCAGATGGCAGAGGG - Intergenic
1113522825 13:110952876-110952898 CTGTGTGTACAGATGGCCTTAGG - Intergenic
1113702549 13:112397961-112397983 CTGTGTGTACAGATGGCCTTAGG + Intronic
1114073643 14:19136367-19136389 CTGTATTTGCTGATTGCAAATGG + Intergenic
1114088620 14:19263618-19263640 CTGTATTTGCTGATTGCAAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1117034660 14:51715644-51715666 CAGTATTTCCAGAAGGCAAAGGG + Intronic
1120375883 14:83706686-83706708 CTGCATCAACAGATGGCAGACGG - Intergenic
1121141509 14:91546592-91546614 CTGTATTTTCACATGGCAGAAGG - Intergenic
1122038901 14:98968223-98968245 CTGTATCTTCACATGGCAGAAGG - Intergenic
1124064578 15:26329515-26329537 GGGTATTTACATATGGTATAAGG - Intergenic
1124149297 15:27162776-27162798 CTGCATTCACAGTTGGGATAAGG + Intronic
1126450587 15:48804163-48804185 CTGTATTTGCACATGGCAGCAGG - Intronic
1127241597 15:57121594-57121616 CTGTATCTTCAAATGGCAGAAGG - Intronic
1127836721 15:62796454-62796476 CTGTGTTTACAGTTGGCAAAGGG - Intronic
1129258743 15:74350676-74350698 CTCCATTTACATAAGGCATATGG + Intronic
1129787108 15:78316734-78316756 CTGTATTTACACAATGCAAATGG - Intergenic
1129828955 15:78654659-78654681 CTGTAGTTACAGACAGTATAGGG - Intronic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1130811737 15:87386191-87386213 CTGAATTTAAAGATGTGATATGG - Intergenic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131323446 15:91420399-91420421 GTGTGTTTAGAGATGCCATATGG + Intergenic
1132777539 16:1603949-1603971 CTGTGTTTCCAGTTGGCACAAGG - Intronic
1133183744 16:4079955-4079977 CTGTTTTGGCAGATGGCAAAGGG - Intronic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1135608502 16:23844313-23844335 CAGTGTTTACATATGGCATTTGG + Intronic
1139458832 16:67106183-67106205 CAGGATTTACAGATTGCATGTGG - Intergenic
1141439156 16:84018160-84018182 CTGTCTTCAGAGGTGGCATAGGG + Intronic
1144242944 17:13331887-13331909 CTGGATTTAAAGATGGAATGAGG + Intergenic
1145899286 17:28479557-28479579 CTGTTTTTACAGATGCCTTTGGG - Intronic
1146677177 17:34781624-34781646 CTGTATTTAGGGATGGCATGTGG - Intergenic
1155689109 18:28595112-28595134 CTGTATTGATTGATGGTATATGG + Intergenic
1157395898 18:47340524-47340546 CTGAATTTCCAGCTTGCATATGG + Intergenic
1162611485 19:11758062-11758084 CTGTTTTTACAGATATCATATGG - Intergenic
1162678500 19:12319823-12319845 CATTTTTTACAGATGTCATATGG - Exonic
1163857168 19:19713079-19713101 CATTTTTTACAGATGTCATATGG - Exonic
1164300024 19:23953892-23953914 CTGTCTTTACAGATGGTTCAAGG - Intergenic
1165709883 19:38003575-38003597 CTGTATTTACAGCTGGGAACTGG - Intronic
925154934 2:1641541-1641563 CTGTATTTAGATATGGCTTTTGG + Intronic
925170758 2:1749058-1749080 CTGTATTTAAGGATGGGGTAGGG - Intergenic
928282994 2:29965054-29965076 CAGTCTTTACAGATGACATCTGG + Intergenic
928361634 2:30666744-30666766 CAGTATTTACAGATAGAAAAAGG - Intergenic
928788305 2:34917590-34917612 CTGTATTTAAAGATCACTTAAGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929058304 2:37898196-37898218 CTGGATTTAAACATGCCATAAGG - Intergenic
929132584 2:38592726-38592748 CTGTATTTACAAATGCCATCAGG + Intronic
932859972 2:75280662-75280684 CTGTATTGACAAATGTCACATGG + Intergenic
933293803 2:80467814-80467836 CTATATTTTCACATGGCAGAAGG - Intronic
933639517 2:84744327-84744349 CTGTAGGTACAGAATGCATATGG - Intronic
936887577 2:117331388-117331410 TTGTATATACATATGCCATATGG + Intergenic
937514984 2:122642823-122642845 CTGCATTTTCACATGGCAAAAGG - Intergenic
938369695 2:130761501-130761523 CTCTATCTACAGATGCCATCAGG - Intronic
938487584 2:131727753-131727775 CTGTATTTGCTGATTGCAAATGG + Intronic
938846594 2:135216170-135216192 CTGTTTCAACATATGGCATATGG - Intronic
940973859 2:159922134-159922156 CAGGATTTACTGATGGGATATGG - Intergenic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
944116414 2:196191785-196191807 CTGTGTTTTCACATGGCAGAAGG + Intergenic
944538344 2:200733225-200733247 TTGTATTTATAGATGCCATCAGG - Intergenic
946045563 2:216818125-216818147 CTGCACTTCCAGGTGGCATATGG - Intergenic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
1169772058 20:9211841-9211863 CTGTATTTTAAGATGGTACATGG + Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1172968325 20:38855187-38855209 CTGTCTTTAGAGATGACACATGG - Intronic
1173032979 20:39379335-39379357 GTGTATTTGCACATGGCACATGG - Intergenic
1174937896 20:54892581-54892603 CTTTATTTACATATTGCCTATGG + Intergenic
1175957412 20:62618436-62618458 CCCATTTTACAGATGGCATAGGG + Intergenic
1176582658 21:8545703-8545725 CTGCATCTTCACATGGCATAAGG - Intergenic
1177201070 21:17956688-17956710 CTGTGTTTTCATATGGCAGAAGG + Intronic
1179612481 21:42561259-42561281 CTGAATTTTCAGATGGCATCTGG + Intronic
1180265490 22:10522751-10522773 CTGCATCTTCACATGGCATAAGG - Intergenic
1180492090 22:15858719-15858741 CTGTATTTGCTGATTGCAAATGG + Intergenic
1183139744 22:35925643-35925665 CTGTATTTAAACATGGGACATGG + Intronic
1183711769 22:39508629-39508651 TTGTATTTACAGGTGGAATCAGG - Intronic
949329423 3:2905415-2905437 CTGTGTTTGCACATGGCAGAAGG + Intronic
949738155 3:7198750-7198772 CAGTTTTTACAGACTGCATAAGG + Intronic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951896837 3:27617607-27617629 CTGCATTTACAAGTGGGATAGGG + Intergenic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
954347004 3:50008466-50008488 ATGTATGTTCAGATGGTATAGGG + Intronic
957419374 3:79949433-79949455 CTGTATTTTAATATGGGATATGG + Intergenic
957607032 3:82413608-82413630 CTGAATTTAAAAATGGCATCAGG + Intergenic
958899291 3:99866795-99866817 CTGTAATTAGAGATGGCATATGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960173072 3:114485761-114485783 CTGTATCTTCATATGGCAAAGGG - Intronic
960375196 3:116892316-116892338 CTGTAATTTCACATGGCAGAAGG + Intronic
963660968 3:148128781-148128803 CTCAACTTGCAGATGGCATATGG + Intergenic
964441855 3:156719398-156719420 CTGTGTTTTCACATGGCAGAAGG - Intergenic
966030471 3:175340418-175340440 CTCTATTTACAGCTGACAGATGG + Intronic
966334947 3:178857456-178857478 CTGTACTAAAAGATGCCATAAGG - Intergenic
973561001 4:52135327-52135349 CTATTTTTACAGATGCCATGTGG + Intergenic
974231617 4:59122910-59122932 AAGTAATGACAGATGGCATAAGG - Intergenic
974762988 4:66302758-66302780 CTGTATTCTTACATGGCATAAGG + Intergenic
977360555 4:95999165-95999187 CTGTATTTGAACATGGCAGAAGG + Intergenic
979210387 4:118093961-118093983 CTGTATTTTCACATGGCAGAAGG + Intronic
979218466 4:118193783-118193805 CTGTAGTTTCAGATGACACATGG + Intronic
979773115 4:124554575-124554597 CTGTAACTTCACATGGCATAAGG + Intergenic
980634927 4:135489719-135489741 CTGTATTTACAGAAAGCAGACGG - Intergenic
981173092 4:141647501-141647523 ATGTATATATAGATGGCTTAGGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982090998 4:151879855-151879877 CTGTTCTTACAGATGCCACAGGG - Intergenic
985822989 5:2173057-2173079 CTGTATTTACAAAGGGCGCATGG + Intergenic
985897464 5:2757310-2757332 CCGAATTTACAGTTGGCAAAGGG - Intergenic
988425425 5:31058018-31058040 CTGTATGTGCAGATGTCATCTGG + Intergenic
991235765 5:64395098-64395120 CCATATTTACAGATGGCACATGG + Intergenic
992335338 5:75761828-75761850 CTGTAGTTACAGAGGTAATAGGG - Intergenic
994780839 5:104088062-104088084 CTGAATTTAAAGATGGAAGAAGG - Intergenic
996531020 5:124527076-124527098 CTGTATTTACTAATGGAATATGG + Intergenic
996596101 5:125204457-125204479 CTCCATTTACATAGGGCATATGG + Intergenic
997672077 5:135683473-135683495 CTGTATTTATAAGTGGGATAAGG + Intergenic
999474156 5:151882756-151882778 GTGTGTTTACAGATGATATAGGG - Intronic
999945217 5:156588405-156588427 CTTTGTTTACATATGGCCTAAGG + Intronic
1000355800 5:160393867-160393889 ATGTAGTTGCAAATGGCATAAGG + Exonic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002629761 5:180563903-180563925 TTGAATTTACAGATGGCTCATGG + Intronic
1005219127 6:23566012-23566034 CTGTATTTACTGAGAGAATAGGG - Intergenic
1010496978 6:76545805-76545827 CTGTAATTTCACATGGCAAAAGG - Intergenic
1011868326 6:91860474-91860496 CTGTATTTATAGCTGACAGAAGG + Intergenic
1012208581 6:96492073-96492095 CTGAGCTTACAGATGGTATATGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1013085706 6:106855237-106855259 CTGTATTGACGTCTGGCATATGG - Intergenic
1013914329 6:115316425-115316447 CTGTTTTTACAGAAGGCTTGTGG + Intergenic
1015072841 6:129117619-129117641 GTGTTTTTTCAGATGGCTTATGG + Intronic
1016067030 6:139694737-139694759 CTGAATTTAGAGAAGACATATGG - Intergenic
1017174868 6:151493787-151493809 CTGTATTTATCGCTGACATAAGG + Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1019095955 6:169579275-169579297 CTGTTTTGACAAATGGCTTAAGG - Intronic
1021301024 7:18973418-18973440 ATGTACTTATAGATGGTATATGG + Intronic
1022222529 7:28327722-28327744 CTATATTTACAGATGTTAAAAGG - Intronic
1024798673 7:53050378-53050400 CTCTATTCAGAGGTGGCATATGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1025287880 7:57683272-57683294 CTGCATCTTCACATGGCATAAGG + Intergenic
1026818542 7:73531024-73531046 CTGTATCTTCACATGGCAGAAGG + Intergenic
1027602297 7:80254276-80254298 CTGTATCTTCATATGGTATAAGG - Intergenic
1029031666 7:97474510-97474532 CTGTATTTACACAAGCCCTAAGG - Intergenic
1030414372 7:109222564-109222586 CTGTATTTATAGATAGTAAAAGG + Intergenic
1031498698 7:122484446-122484468 CAGTATTTCTGGATGGCATATGG - Intronic
1032892431 7:136212908-136212930 CTGCATCTTCACATGGCATAAGG + Intergenic
1034592556 7:152154511-152154533 CTGTATTCACAGATGTCAGCAGG - Intronic
1036842067 8:12131600-12131622 GTGTGTTTACAAATGGCATTTGG - Intergenic
1036863900 8:12377850-12377872 GTGTGTTTACAAATGGCATTTGG - Intergenic
1037270327 8:17121518-17121540 ACGTATTTACATATTGCATATGG + Exonic
1038609828 8:29050141-29050163 CTTTTTTTACAGATGCCCTAAGG + Intronic
1039958924 8:42229709-42229731 CAGCATTTACAGATTGCACATGG + Intergenic
1041111220 8:54484605-54484627 CTTTATTCACAAATGACATATGG - Intergenic
1042646732 8:70995386-70995408 TTGAATTGACATATGGCATATGG + Intergenic
1045316716 8:101049653-101049675 TTGTATTTTCAGAAGGGATAGGG + Intergenic
1048367076 8:133747376-133747398 CTGTGTTTTCATATGGCAGAAGG - Intergenic
1049160139 8:141092139-141092161 GTGTAGATACAGATGGGATAAGG + Intergenic
1050446788 9:5731651-5731673 CTATATATGGAGATGGCATATGG + Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1051557218 9:18397841-18397863 CTGGATTTCCAGATGTCTTAAGG + Intergenic
1055274256 9:74596412-74596434 TTGTATTTAGAGATTGCACAAGG - Intronic
1056282160 9:85052113-85052135 CTGTTTTTTCAGATGACAGAAGG - Intergenic
1056343184 9:85659447-85659469 ATGTATTTTCAGATGACACATGG - Intronic
1056744971 9:89292867-89292889 ATGTATTTACAGTTGTGATAAGG - Intergenic
1057582991 9:96304081-96304103 CTGTATTTAGAGATGGTTTCAGG + Intergenic
1060498759 9:124137109-124137131 CAGGAATTACAGAGGGCATATGG - Intergenic
1060582747 9:124766532-124766554 CTGTTTTTACACATGAAATAAGG + Intronic
1203612678 Un_KI270749v1:23711-23733 CTGCATCTTCACATGGCATAAGG - Intergenic
1186068826 X:5795516-5795538 CTGTTTTTGCTGATGGTATACGG + Intergenic
1186257328 X:7736691-7736713 CTGTGTTTTCACATGGCAAAAGG + Intergenic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1196458525 X:115906540-115906562 CTTTAATAACAGATGGCACAGGG - Intergenic
1197551851 X:127901363-127901385 CTGTCTTCACAGGTGGCAGATGG + Intergenic
1201510690 Y:14758247-14758269 CTGTATTTGCAAATGGATTAAGG + Intronic