ID: 1050863757

View in Genome Browser
Species Human (GRCh38)
Location 9:10470800-10470822
Sequence AAGGAAACAGGAGTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050863751_1050863757 13 Left 1050863751 9:10470764-10470786 CCACTGGAATAGACTATCTTTAG 0: 1
1: 0
2: 1
3: 14
4: 141
Right 1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050863757 Original CRISPR AAGGAAACAGGAGTGGTGGA GGG Intronic
No off target data available for this crispr