ID: 1050868213

View in Genome Browser
Species Human (GRCh38)
Location 9:10531345-10531367
Sequence TGCATAGTATGGTGATTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 3, 2: 9, 3: 33, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050868213_1050868215 0 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868215 9:10531368-10531390 AAAATGCACAACAAAAACATAGG No data
1050868213_1050868218 9 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868218 9:10531377-10531399 AACAAAAACATAGGGATGATGGG No data
1050868213_1050868217 8 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868217 9:10531376-10531398 CAACAAAAACATAGGGATGATGG No data
1050868213_1050868221 17 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868221 9:10531385-10531407 CATAGGGATGATGGGGAAATGGG No data
1050868213_1050868220 16 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG No data
1050868213_1050868219 10 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868219 9:10531378-10531400 ACAAAAACATAGGGATGATGGGG No data
1050868213_1050868216 1 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868216 9:10531369-10531391 AAATGCACAACAAAAACATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050868213 Original CRISPR TGCATAGTATGGTGATTTTT AGG (reversed) Intronic
901253396 1:7799184-7799206 TGCATAGGATGGTAATTTGCAGG - Intronic
901289428 1:8111807-8111829 GGCATACTATGGAGATATTTTGG - Intergenic
902180007 1:14680800-14680822 TACATGGTATGGTGTGTTTTAGG + Intronic
906239331 1:44232512-44232534 TGAATAGTCTGATGATTTTGTGG - Intronic
907465518 1:54632994-54633016 TGCATTGTATGCTGACTTTGAGG - Intronic
907974388 1:59416981-59417003 TACATAAAATGGTGAATTTTAGG - Intronic
910677227 1:89826939-89826961 TTCATAGGATGGTGTTTTGTTGG + Intronic
912037887 1:105344881-105344903 TGCATTGTTAGGTGATTTTGTGG - Intergenic
912488028 1:110044437-110044459 TGCAAGGTATGCTGATTGTTTGG + Intronic
912653073 1:111458432-111458454 TGCAAAGTATGTGGATTTTTGGG + Intronic
913137605 1:115907913-115907935 TGCAGAGTCTGGGCATTTTTAGG + Intergenic
914767901 1:150655443-150655465 TGCATCATATGTTGATTTTGAGG - Intronic
917773680 1:178309664-178309686 TGCATAGTGTAGTGATTTTTAGG - Intronic
917799531 1:178558255-178558277 TGCATTGTATGTTGACTTTGAGG + Intergenic
917878606 1:179310618-179310640 TCCATAGTATGGTTAGGTTTAGG - Intronic
918026623 1:180755821-180755843 TGCATAGTGCAGTGATCTTTAGG + Intronic
918216909 1:182399757-182399779 TGCATAATATGGAGCTTCTTTGG + Exonic
918350920 1:183654783-183654805 TGCATTTTAGGGTGATTTTAGGG + Intronic
918557282 1:185817806-185817828 TACACAGCCTGGTGATTTTTAGG - Intronic
920865263 1:209747365-209747387 TGCATAGCATAATGATGTTTTGG - Intergenic
923155803 1:231278502-231278524 TGCATAGTAGGTTCATTTTGAGG + Intergenic
923936555 1:238766978-238767000 TGAAGAGTAGGGTGATTATTTGG + Intergenic
1066144574 10:32542999-32543021 TGCATAGTGAGGTGATTTTCAGG + Intronic
1066244949 10:33573673-33573695 TGCATTGTGTTGTGATTATTAGG - Intergenic
1066990486 10:42508695-42508717 TGCATTGTATGTTGACTTTGAGG + Intergenic
1068285988 10:54935519-54935541 TGCACACTATAGTGACTTTTAGG - Intronic
1068387209 10:56346771-56346793 TGTATAGGATGGTGAGGTTTAGG - Intergenic
1069262761 10:66419558-66419580 TGGATATTCTGGTTATTTTTTGG - Intronic
1071906023 10:90174420-90174442 TGCATAGCATGGTGATTTTTAGG - Intergenic
1076416481 10:130293522-130293544 TGCATCATATGTTGATTTTGAGG - Intergenic
1078125554 11:8558304-8558326 TGCATAGTGTAGTGATTTTTAGG - Intronic
1078685931 11:13532138-13532160 TGCATATTCTGTTGATTTTGGGG + Intergenic
1080491575 11:32770216-32770238 TTCATAGCATGGTGATCTCTGGG + Intronic
1080738754 11:35043762-35043784 TGCATACAATAGTTATTTTTAGG + Intergenic
1081889364 11:46527608-46527630 TGTTTAGTATGGTTATTTGTGGG - Intronic
1082129252 11:48468316-48468338 TGAATAGTATGGTGGTTGTGAGG - Intergenic
1082175747 11:49056973-49056995 TGCATACTTTGGTAATCTTTGGG - Intronic
1082213616 11:49537747-49537769 TGCTTAGTATGATGATTGGTAGG + Intergenic
1082562786 11:54639208-54639230 TGAATAGTATGGTGGTTGTGAGG - Intergenic
1086693971 11:89822184-89822206 TGCATATTCTGGTAATCTTTGGG + Intergenic
1086698664 11:89873874-89873896 TGCATACTTTGGTAATCTTTGGG - Intronic
1086707506 11:89970627-89970649 TGCATACTTTGGTAATCTTTGGG + Intronic
1086712176 11:90022385-90022407 TGCATATTCTGGTAATCTTTGGG - Intergenic
1089870596 11:121669364-121669386 TGCATACTATTGGGAGTTTTAGG + Intergenic
1093222416 12:16438461-16438483 TGCTTAGCAGGGTGATTTTAGGG + Intronic
1093722409 12:22460438-22460460 TACTTAGTGTGTTGATTTTTTGG + Intronic
1093898168 12:24599634-24599656 TGTATAGGAAGGTGATTTTGAGG + Intergenic
1094040436 12:26115558-26115580 GGAATAGTATGGTTATTTGTAGG + Intergenic
1095185620 12:39197604-39197626 TGCATTGTATGTTGACTTTGAGG + Intergenic
1095371592 12:41473867-41473889 TACTTAGTATTGTAATTTTTAGG + Intronic
1095402411 12:41830101-41830123 TACATATTTTGGTTATTTTTTGG - Intergenic
1097450274 12:59729628-59729650 TGCATAGATAGGTGATTTTGTGG + Intronic
1097674200 12:62580519-62580541 AGAATGGTAAGGTGATTTTTAGG + Intronic
1098603906 12:72366689-72366711 TACATACTATGGGGGTTTTTGGG - Intronic
1098844026 12:75513116-75513138 TGCATAGTATGGTAATTAAAAGG - Intergenic
1099213889 12:79830180-79830202 TTAATAGTATGGTTATTTTGAGG - Intronic
1100956468 12:99914703-99914725 TGCATGGGAGGGTGATATTTAGG + Intronic
1101182700 12:102236735-102236757 TGAATATTATGTTAATTTTTTGG - Intergenic
1101501323 12:105307042-105307064 TGCATTGTATGTTGACTTTGAGG + Intronic
1101643603 12:106607191-106607213 TGTATAATGTGGTGATTTTTAGG - Intronic
1102313627 12:111867494-111867516 TACCTAGTATGGTCAGTTTTTGG + Intronic
1105352517 13:19628513-19628535 TGCATTGTATGTTGACTTTGAGG - Intergenic
1106790126 13:33146557-33146579 TGTATGCTTTGGTGATTTTTTGG + Intronic
1107248140 13:38322501-38322523 TAAATAGTATGGTGATCTTTGGG - Intergenic
1109263977 13:60175509-60175531 TGCACAGTCTTGTGGTTTTTAGG + Intergenic
1109264111 13:60176872-60176894 TGCACAGTCTTGTGGTTTTTAGG - Intergenic
1110640439 13:77817920-77817942 TGCATAGGGCAGTGATTTTTAGG + Intergenic
1110988408 13:82004848-82004870 TGCATAATATGGGGTTTCTTAGG + Intergenic
1111553274 13:89845348-89845370 TGCATAGTATGATTATCTTTAGG + Intergenic
1112171636 13:96978348-96978370 GGCTTAGTTTTGTGATTTTTAGG - Intergenic
1112367812 13:98770735-98770757 TGTATAGTATGATGAGTTTTAGG + Intergenic
1113535050 13:111059319-111059341 TGCATAGTGTGGTGGCTTCTAGG + Intergenic
1114052036 14:18928604-18928626 GGCATAGCATTGTGAGTTTTTGG + Intergenic
1114110523 14:19473319-19473341 GGCATAGCATTGTGAGTTTTTGG - Intergenic
1116733495 14:48657292-48657314 TGCATATTATGATGATTTTTAGG + Intergenic
1119136037 14:72221209-72221231 TGCAAAATCTTGTGATTTTTTGG - Intronic
1122908476 14:104814604-104814626 TACATGGTATGCTGCTTTTTGGG - Intergenic
1125010819 15:34872295-34872317 TGCATAGTATTCTTATTTTGGGG + Intronic
1126278433 15:46913800-46913822 AGCATAGAATGGTGGTTTCTAGG + Intergenic
1126395119 15:48207133-48207155 TGCAAAGTATTTTGATTGTTAGG - Intronic
1126904412 15:53348956-53348978 TGCACAGAACAGTGATTTTTAGG - Intergenic
1127575754 15:60290235-60290257 CCCAAAGTATGGAGATTTTTAGG - Intergenic
1128855574 15:71010962-71010984 CTCATAGTATGCTGAATTTTTGG - Intronic
1130209445 15:81909865-81909887 TGCACAGTAAGATGAATTTTGGG - Intergenic
1130721559 15:86391323-86391345 TGCATAGTATGTACCTTTTTTGG + Intronic
1130955933 15:88627303-88627325 TACACAGTGTGATGATTTTTTGG - Intronic
1131823248 15:96294075-96294097 TGCAGAGCATGGTGCTGTTTTGG - Intergenic
1133408667 16:5549570-5549592 TGCATAGTATAGTCAAGTTTAGG - Intergenic
1133483977 16:6200500-6200522 TACACAGAGTGGTGATTTTTAGG - Intronic
1134421294 16:14092166-14092188 TACATAGTTTTGTGATTATTTGG + Intronic
1137260224 16:46821163-46821185 TGCAAAGCATGGTAAGTTTTAGG - Intronic
1139710553 16:68772602-68772624 GACATAGTGTGGTGATTTTGAGG - Intronic
1140795033 16:78429408-78429430 TGGATATCATGGTGATTTTTTGG - Intronic
1142544461 17:689797-689819 TGCATAATATGCTAATTTTGAGG + Intronic
1143430412 17:6878787-6878809 TGCATTGTATGTTGACTTTGAGG + Intronic
1144445100 17:15319906-15319928 TGCATAGTATGACAACTTTTTGG - Intronic
1147040724 17:37716561-37716583 AGCAAACTCTGGTGATTTTTAGG + Intronic
1152998690 18:433013-433035 TGCACAGTGTGATGATTGTTAGG + Intronic
1153184803 18:2474107-2474129 TGCATAGTATAGTGCATTTGAGG + Intergenic
1154088724 18:11336160-11336182 TGCATAGTTAGGTGATTTCATGG - Intergenic
1158375453 18:56858348-56858370 TGAATTATATGGTGATTATTAGG - Intronic
1158614593 18:58974990-58975012 TGCATAGTGCAGTGATTTTTAGG + Intronic
1159680335 18:71342432-71342454 TGCATATTATGGTAATTTAGAGG + Intergenic
1160608297 18:80068477-80068499 AGAATAATATGGTGATATTTTGG - Intronic
1162283043 19:9715788-9715810 TGCATCATATGTTGATTTTGAGG + Intergenic
1162652538 19:12101544-12101566 TGCATTGTATGTTGACTTTGAGG + Intronic
1164024846 19:21342539-21342561 TGCATTGTATGTTGACTTTGAGG + Intergenic
1164662658 19:29990740-29990762 TAAAGAGTATGGAGATTTTTAGG + Intronic
1165276967 19:34762169-34762191 TGCATAATATGTTCATTTTGGGG - Intronic
1167863431 19:52304699-52304721 TGCATCGTATGCTGACTTTGAGG + Intronic
927585989 2:24305791-24305813 TGTGTATTATGGTGTTTTTTAGG - Intronic
928907175 2:36380724-36380746 TTCAAAGTCTGATGATTTTTTGG - Intronic
929939198 2:46318673-46318695 TGCATAGTGTGGTGATTTTTAGG + Intronic
930080173 2:47440033-47440055 TGCATAGTGTTCTGATTTTTAGG + Intronic
931153812 2:59604957-59604979 TTGATAGTATGATTATTTTTTGG + Intergenic
931528675 2:63187490-63187512 TGCATTGTATGGATATTTTGTGG + Intronic
933402911 2:81821374-81821396 AACATTGTATGGTGTTTTTTCGG - Intergenic
933588455 2:84205331-84205353 TGCATAGCATGGTGATGTTCAGG - Intergenic
934886807 2:98032178-98032200 TGCATGTGATGGTGAATTTTAGG - Intergenic
935498592 2:103810809-103810831 TGCAAAGTCTGGAGAATTTTAGG - Intergenic
935613362 2:105049526-105049548 TACTTAGTATGGTGAGTTTTAGG + Intronic
937930165 2:127198563-127198585 TGCATCGTATAGTGATGTTTTGG + Intronic
938917118 2:135953095-135953117 TGCATAGGACGGTTAGTTTTAGG + Intronic
939437207 2:142193372-142193394 TGCATAATATGGTTCTTTTTTGG + Intergenic
940310864 2:152277789-152277811 TGCATCGTATGTTGACTTTGAGG + Intergenic
941697450 2:168568799-168568821 TGCATGGTGTGGCCATTTTTAGG - Intronic
941704493 2:168643530-168643552 TGTATAGAATGGTGCATTTTTGG - Intronic
943487558 2:188505445-188505467 TTCATAGTATGGAGTTATTTGGG - Intronic
947581934 2:231325657-231325679 TGCATTTTATGATGAATTTTAGG - Intronic
1169501352 20:6163682-6163704 TGCCTAGTAGGAGGATTTTTCGG - Intergenic
1171002299 20:21426731-21426753 TGGATAGTATGTGGATTGTTGGG - Intergenic
1172451158 20:35024195-35024217 ACCATGGTATCGTGATTTTTAGG + Intronic
1173067136 20:39723799-39723821 TGCATTGTATGTTGACTTTGAGG - Intergenic
1173395535 20:42676322-42676344 GACATAGTGTGGTGATTTTTAGG + Intronic
1174235173 20:49084004-49084026 TGTATATTATTGTGTTTTTTAGG + Exonic
1175307583 20:57987523-57987545 TGCATGCTACCGTGATTTTTAGG - Intergenic
1180374270 22:12076067-12076089 TGCATCATATGTTGATTTTGAGG - Intergenic
1180470509 22:15650978-15651000 GGCATAGCATTGTGAGTTTTTGG + Intergenic
1180677575 22:17598342-17598364 TGTATAGTCTGTTGAGTTTTTGG - Intronic
949160140 3:872232-872254 TGCATCGCAAGGTGAATTTTAGG + Intergenic
950803136 3:15571565-15571587 TGCACATCAAGGTGATTTTTAGG + Intronic
950850970 3:16062029-16062051 TGCATAGTTTGGTGATATATAGG + Intergenic
950954200 3:17033961-17033983 TGTATAGTGAGGTGAGTTTTAGG + Intronic
950971916 3:17197698-17197720 TGCATAGCATAGTGATTTTGGGG + Intronic
951768246 3:26224843-26224865 TGCATAGTATGGGAAATTGTAGG - Intergenic
952671003 3:35968275-35968297 TGAATAACATGGTGCTTTTTTGG + Intergenic
953294337 3:41698164-41698186 TGCCTTGTTTGGTGATTTTTTGG - Intronic
953368209 3:42365257-42365279 TGCATAGTATGATTTTATTTTGG + Intergenic
953967947 3:47324531-47324553 TGCTTAGAAAAGTGATTTTTAGG + Intronic
954724238 3:52593891-52593913 TGCATATTCTGTTGATCTTTGGG + Intronic
956991536 3:74772065-74772087 TGCATTCTAAGGTGATTCTTAGG - Intergenic
957012278 3:75021174-75021196 TGTATAGTATTTTGCTTTTTTGG + Intergenic
957786888 3:84894506-84894528 TGCATAGTACAGTGCTTTGTAGG - Intergenic
957836342 3:85595966-85595988 TATTTGGTATGGTGATTTTTAGG - Intronic
957966506 3:87328454-87328476 TGGATAGTATGGACATTTTATGG - Intergenic
958845079 3:99256693-99256715 TGCACAGTTTGATGCTTTTTCGG + Intergenic
958874048 3:99595386-99595408 TGCATTGCATAGTGATTTTCAGG - Intergenic
960523601 3:118683493-118683515 TGCGTAGTGCAGTGATTTTTAGG - Intergenic
961777426 3:129298679-129298701 TGCATAGTACAGTGATTTTTAGG - Intronic
962432009 3:135328656-135328678 TGCATACTATGGGCATTTCTGGG - Intergenic
962493012 3:135911714-135911736 TGCATTTTATGGTGCTTATTTGG + Intergenic
966049289 3:175593926-175593948 TGCAGAGGATTGTTATTTTTAGG + Intronic
966056259 3:175694080-175694102 TTCATAGTATAGTAATGTTTTGG + Intronic
966629742 3:182059290-182059312 TACATAGTTTGGTGTTTTGTGGG - Intergenic
968256002 3:197272501-197272523 TTCATAGTGTGGTGATTTTTAGG + Intronic
970942144 4:21647032-21647054 TGAATAGAATGGTGATTTGAGGG + Intronic
971903727 4:32698062-32698084 TACATAGTGTGGTAATTTTAAGG + Intergenic
972080437 4:35142473-35142495 TGCATTGTATGTTGACTTTGAGG - Intergenic
974296471 4:60005666-60005688 TGCATAGTATAGTCAGTTTTGGG + Intergenic
974450959 4:62058637-62058659 TACATACGATGGTGAATTTTGGG - Intronic
974954508 4:68621431-68621453 TGCATATTCTGTTGACTTTTGGG - Intronic
975231813 4:71944499-71944521 TGCATACTAGTGTGATGTTTGGG - Intergenic
976977699 4:91184818-91184840 TGCATTGTATGTTGATTTTTAGG + Intronic
977856753 4:101904630-101904652 TGCATTGTATGTTGACTTTGAGG + Intronic
978512849 4:109540456-109540478 AGTATGGTTTGGTGATTTTTTGG + Exonic
979451508 4:120876508-120876530 GGCATAGTACAGTGACTTTTAGG + Intronic
980286648 4:130787418-130787440 TGCATATTTTAATGATTTTTCGG + Intergenic
982170669 4:152658510-152658532 TTCATTGAATGGTTATTTTTGGG + Intronic
983211660 4:164964666-164964688 AGAATATTATAGTGATTTTTTGG + Intronic
984370187 4:178854066-178854088 AGCATGGTATTGTGATTTGTGGG + Intergenic
984515557 4:180734336-180734358 TGCATAGCATAGTTATTTTTAGG - Intergenic
984956256 4:185048957-185048979 TGCATCGTATGTTGATTATGAGG + Intergenic
985314686 4:188644022-188644044 TGCACAGCATGGAGATTCTTAGG - Intergenic
986005340 5:3662960-3662982 TGAATATTATTGTGATTTCTAGG + Intergenic
986991925 5:13564343-13564365 TGGATTGTGTGGTGTTTTTTTGG - Intergenic
987615358 5:20266927-20266949 TGCATAATATGTTCATTTTGGGG + Intronic
988849166 5:35161492-35161514 TGGATAGAGTTGTGATTTTTAGG - Intronic
989742657 5:44790776-44790798 TGCATCATATGTTGATTTTGAGG - Intergenic
989992566 5:50785256-50785278 TGCATAGTATGATTAAGTTTTGG + Intronic
990109628 5:52307218-52307240 TGCATTGTATGTTGACTTTGAGG - Intergenic
991298934 5:65108852-65108874 TGGTTAAAATGGTGATTTTTGGG - Intergenic
992585955 5:78239979-78240001 TGCATAGTATGGTCATTTTTTGG - Intronic
993028477 5:82674201-82674223 TGCATAGCATGATGGTTTTTAGG - Intergenic
993548177 5:89239503-89239525 TACATAGAAATGTGATTTTTGGG + Intergenic
994872775 5:105374852-105374874 TCCATTTTTTGGTGATTTTTAGG + Intergenic
995731468 5:115247366-115247388 TTAATAGTATGGTGATATTTTGG - Intronic
997983289 5:138483862-138483884 TGCAAAGTGTGGTCTTTTTTGGG - Intergenic
998676964 5:144420309-144420331 GGCAGATTATGGTGATATTTAGG + Intronic
1005188695 6:23193136-23193158 TGCATAGTATCTTAATTTATGGG + Intergenic
1005231760 6:23709733-23709755 TGCATTCCATGGTAATTTTTAGG - Intergenic
1005400951 6:25434055-25434077 TGCATTTTATGGGAATTTTTTGG + Intronic
1005858134 6:29879752-29879774 TGCATTGTTTGTTGATTTTCAGG + Intergenic
1006064049 6:31448965-31448987 TGCATTGTATAATGATGTTTGGG - Intergenic
1006278336 6:33024362-33024384 TGAATAGAATGGTGGTTATTAGG - Intergenic
1007449868 6:41934734-41934756 TGCATGGCATAGTGATTTTTAGG + Intergenic
1009684488 6:66937832-66937854 TATATAATATGGTGATTTCTGGG - Intergenic
1010709448 6:79155768-79155790 TGCTTATTATGGTGGTATTTTGG - Intergenic
1011560542 6:88609419-88609441 TGCATAGAGTGGTTATGTTTAGG + Intergenic
1011928206 6:92674427-92674449 TGCATATTTTGTTGTTTTTTGGG - Intergenic
1012159898 6:95871437-95871459 TGTATAGAATGGTGTTTTCTAGG - Intergenic
1012571922 6:100740398-100740420 TGTATATTCTGTTGATTTTTGGG + Intronic
1012998967 6:106002419-106002441 TTCATAGTATGTTTATTTTGGGG + Intergenic
1013345047 6:109251904-109251926 TACATAATATGGTTATTTTAAGG - Intergenic
1015952529 6:138567718-138567740 TGCCTAGTATGGTCATTCTCTGG + Intronic
1016311863 6:142742510-142742532 TGCATAGTACAATGATTTTTGGG - Intergenic
1016925973 6:149348559-149348581 TGCATAGCATGGTGATATTTAGG - Intronic
1017860975 6:158397038-158397060 TCAATAGTAAGGTGAATTTTAGG + Intronic
1018594206 6:165460808-165460830 TGCATTGTATGTTGATTCTGAGG - Intronic
1019081955 6:169439096-169439118 TGCATCGTTTGATGTTTTTTTGG - Intergenic
1019814560 7:3190061-3190083 AGCATTGCTTGGTGATTTTTTGG - Intergenic
1021018224 7:15562925-15562947 TGTACAGTATAGTGATTTTTAGG - Intergenic
1022180019 7:27910168-27910190 TGCACAGTATAGTGAGATTTTGG + Intronic
1024102030 7:46042413-46042435 TGCATTGTATGTTGACTTTGAGG + Intergenic
1025122754 7:56319121-56319143 TGCATTGTATGTTGACTTTGAGG - Intergenic
1026476563 7:70741243-70741265 TGAACAGCATGGTGATTTTAAGG - Intronic
1031004891 7:116459184-116459206 AGCATAGTTTTGTGATTTTTAGG - Intronic
1031844272 7:126785558-126785580 TGTACAGTATGGTAATTTTTAGG + Intronic
1033624981 7:143101250-143101272 TGCATATTGCAGTGATTTTTAGG + Intergenic
1034113312 7:148559435-148559457 TACATAGTACTTTGATTTTTAGG + Intergenic
1034684285 7:152956439-152956461 TGCATAACATGGTAACTTTTAGG - Intergenic
1036054442 8:5235384-5235406 TACATATTATGGTGATTTTTAGG + Intergenic
1037202422 8:16273379-16273401 TGCATTGTATAATGACTTTTTGG - Intronic
1040609138 8:48965014-48965036 TGCATTGTATGTTGACTTTGAGG - Intergenic
1042487084 8:69357585-69357607 TTCATAGTATGTTAATTTATTGG + Intergenic
1043666726 8:82824877-82824899 TGCATACACTGGTGATGTTTTGG + Intergenic
1043792100 8:84483466-84483488 TTCATAGGATGGTGATATTCTGG + Intronic
1045143760 8:99316033-99316055 TGCATTATATGGTGGTTTTCTGG + Intronic
1046351649 8:113022607-113022629 TCCTGAGTATGGAGATTTTTAGG - Intronic
1046887111 8:119379335-119379357 TGTATATTCTGTTGATTTTTGGG - Intergenic
1047216933 8:122883539-122883561 TGCATAGTGTGGTGGTTTGGGGG - Intronic
1047563047 8:126009776-126009798 TGCACCGTATGTTGATTTTGAGG - Intergenic
1047824474 8:128558728-128558750 TGCATAGAATGGTGGTTACTGGG + Intergenic
1048686516 8:136910790-136910812 TGCATTGTATGTTGACTTTGAGG + Intergenic
1048711536 8:137217391-137217413 TACAAAGTGTGGTGATTTTTAGG + Intergenic
1049187462 8:141265076-141265098 TGCATATTTTGGTGATGGTTTGG - Intronic
1050868213 9:10531345-10531367 TGCATAGTATGGTGATTTTTAGG - Intronic
1051202379 9:14641924-14641946 TACACAGTGAGGTGATTTTTAGG + Intronic
1051570668 9:18555074-18555096 TCCTTAGTTTGGTGTTTTTTAGG + Intronic
1055127567 9:72736791-72736813 TGCATAGTGTCGGGATTTTTAGG - Intronic
1055587891 9:77775128-77775150 TGCATAGTATTTTATTTTTTAGG + Intronic
1056147324 9:83745346-83745368 TGCAGAGACTAGTGATTTTTAGG + Intronic
1056414188 9:86360571-86360593 TGCATAGAAGGCTGATTTATGGG - Intergenic
1057285845 9:93753599-93753621 TGCATTGTATGTTGACTTTGAGG + Intergenic
1058533133 9:105926687-105926709 TGCAAATTATGGCGATTTTGAGG + Intergenic
1061602816 9:131683080-131683102 TGCATTGTATGTTGACTTTGAGG - Intronic
1203536658 Un_KI270743v1:46343-46365 TGCATCATATGTTGATTTTGAGG - Intergenic
1186510919 X:10129188-10129210 TGCACAGTTAGGTGGTTTTTAGG + Intronic
1186520163 X:10199206-10199228 TGCATGGCATGGTGATTTTTAGG - Intronic
1186768740 X:12796674-12796696 TGCATAGCGTGGTAATTTTTAGG - Intronic
1186884551 X:13900139-13900161 TGCAAAGAGTGATGATTTTTAGG - Intronic
1187262628 X:17701336-17701358 TGTACAGTGTGGAGATTTTTAGG - Intronic
1187993665 X:24902709-24902731 TCCATAGCTTAGTGATTTTTAGG - Intronic
1188090385 X:25957062-25957084 TTCATAGTATGGTTCTTTTATGG - Intergenic
1188604192 X:32007953-32007975 TCCATATAATGGTGATATTTTGG + Intronic
1188633293 X:32395638-32395660 TGTATAATCTGGTGATTTTTAGG + Intronic
1188694625 X:33175385-33175407 GGCCTAGTATGTTGAATTTTAGG - Intronic
1190409754 X:50124850-50124872 TGCATAGCATTATGATTTTGAGG + Intergenic
1191151265 X:57222685-57222707 TGGTTAGTATGGTGATTGGTAGG - Intergenic
1191732762 X:64354979-64355001 TGCATTGTTTGATGATTTTTAGG - Intronic
1191833580 X:65441100-65441122 TGCATTGTATGTTGACTTTGTGG + Intronic
1192687467 X:73322385-73322407 TGCATTGTATGTTGACTTTGAGG + Intergenic
1192707774 X:73545003-73545025 TGGATAGTATGGCCATTTTCTGG - Intergenic
1193116066 X:77776466-77776488 TACATAGTTTGGTGGTTTTTAGG - Intronic
1194985153 X:100482156-100482178 TGCATAGTGTGTAGATTTTAAGG - Intergenic
1195310643 X:103629166-103629188 TGCAAAATATGGTGGTCTTTGGG + Intronic
1196668483 X:118341633-118341655 TGCATAGCAGAGTGATTTTTAGG - Intergenic
1198483445 X:137062604-137062626 TGCACAGTGTGGAAATTTTTAGG + Intergenic
1199395259 X:147330087-147330109 TGAATACTCTGGTTATTTTTAGG - Intergenic
1201370263 Y:13255262-13255284 TGCATTGTATGTTGACTTTGAGG - Intronic
1201406210 Y:13652739-13652761 TGCATAGTCTGTTTATTCTTAGG + Intergenic