ID: 1050868214

View in Genome Browser
Species Human (GRCh38)
Location 9:10531356-10531378
Sequence TTGTGCATTTTTGCATAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 242}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050868214_1050868220 5 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG No data
1050868214_1050868216 -10 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868216 9:10531369-10531391 AAATGCACAACAAAAACATAGGG No data
1050868214_1050868217 -3 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868217 9:10531376-10531398 CAACAAAAACATAGGGATGATGG No data
1050868214_1050868218 -2 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868218 9:10531377-10531399 AACAAAAACATAGGGATGATGGG No data
1050868214_1050868221 6 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868221 9:10531385-10531407 CATAGGGATGATGGGGAAATGGG No data
1050868214_1050868219 -1 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868219 9:10531378-10531400 ACAAAAACATAGGGATGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050868214 Original CRISPR TTGTGCATTTTTGCATAGTA TGG (reversed) Intronic
903082120 1:20819149-20819171 TTGTGCTTTTTTGCATATATTGG - Intronic
908508565 1:64830697-64830719 TTGTGTATTTTTTGATAGTTTGG + Intronic
909211017 1:72823568-72823590 TTCTGCTTTTTTGCATACTTTGG - Intergenic
910614106 1:89178151-89178173 TTTTGTATTTTTGCAGAGTCGGG - Intergenic
911598854 1:99825876-99825898 ATGTGCATATTTGCAGAGTCAGG + Intergenic
912404995 1:109429937-109429959 TTGCACATTTTTGCAAAGAAAGG + Intergenic
913099453 1:115549825-115549847 TAGTGCATTTTAGCATGATAAGG - Intergenic
913325847 1:117627984-117628006 TTGTGTGTGTTTGCATAGGAAGG + Exonic
916371926 1:164107751-164107773 TTCTGTATTTCTGCATATTATGG - Intergenic
918320901 1:183363739-183363761 ATCTGCAATTTTGAATAGTAAGG + Intronic
918412532 1:184274690-184274712 TTTTGCTTTTTTGCTTAGGATGG - Intergenic
919553008 1:199015784-199015806 TGTTACATTTTTGAATAGTAGGG - Intergenic
919749404 1:201027343-201027365 TTGTCCAAAGTTGCATAGTAAGG + Intergenic
920361870 1:205424066-205424088 TTGTGCATTCTTCCAAAGAATGG - Intronic
923067307 1:230530230-230530252 TTTTTCCTTTTTGCTTAGTATGG - Intergenic
923436966 1:233976581-233976603 TTGTGCATAATTTCATAGTATGG + Intronic
924107024 1:240659215-240659237 TTATGCATTTTTGCAATTTATGG + Intergenic
1064454061 10:15470267-15470289 TTGCGCATTTTGGCATGATAGGG + Intergenic
1065415536 10:25481321-25481343 TTCTGCATTTATGCAGATTATGG + Intronic
1065575315 10:27112278-27112300 TTGTGCATTATAACATAGTAAGG + Intronic
1067500119 10:46796033-46796055 TTGTGCCTATTTGAATAGTGGGG + Intergenic
1067594513 10:47544280-47544302 TTGTGCCTATTTGAATAGTGGGG - Intronic
1067641621 10:48052395-48052417 TTGTGCCTATTTGAATAGTGGGG - Intergenic
1067679685 10:48423445-48423467 TTGTTCCTTTTGGGATAGTAGGG + Intronic
1069461615 10:68600155-68600177 TTGTGCATTTTTACTTTATAAGG - Intronic
1070084393 10:73222130-73222152 TTGTGCATTTTACCTTACTAAGG + Intronic
1070138872 10:73721253-73721275 TTGTGCCTATTTGAATAGTGGGG - Intergenic
1070338883 10:75478741-75478763 TGGTGCATTTTTACAAGGTATGG + Intronic
1071606822 10:86999678-86999700 TTGTGCCTATTTGAATAGTGGGG + Intergenic
1071906024 10:90174431-90174453 TTGTGTGATTTTGCATAGCATGG - Intergenic
1073739546 10:106391052-106391074 TTGGAAATTTTTCCATAGTATGG + Intergenic
1073787366 10:106904593-106904615 TTGTGCGTTTGTCCAAAGTATGG - Intronic
1076171734 10:128325632-128325654 TTGGGCATTTCTGCAAAGCAGGG + Intergenic
1078849901 11:15154173-15154195 GTGTGCATTTTATCATAGTCAGG - Intronic
1079061672 11:17254070-17254092 TTGTGCATTTAAACATAGAAAGG + Intronic
1081345491 11:41980802-41980824 TTGTGCAGTATTGCATTGTGAGG + Intergenic
1082815857 11:57508599-57508621 TTGTCCATTCTTGCAAAGCAGGG - Intronic
1086909143 11:92451845-92451867 TTGTGCATTTCTGCATGTCATGG + Intronic
1086931803 11:92701589-92701611 TTCTACATTTTTGCATTTTATGG - Intronic
1088102591 11:106171611-106171633 TTGTAAATTTTTGGATATTAGGG + Intergenic
1090735157 11:129606344-129606366 TTTTGCCTTTTTGCATTGGAGGG - Intergenic
1092533053 12:9361196-9361218 TTCTGCACTTTTGCATAGAATGG + Intergenic
1092903940 12:13085239-13085261 TTGTGCATTTGTCCCTAGCATGG - Exonic
1093020830 12:14202473-14202495 TTCTGCATTTTGGCACTGTAGGG - Intergenic
1093279215 12:17170991-17171013 ATGTGCATTTTTTCAGAGAAAGG + Intergenic
1093304792 12:17501879-17501901 TTGTGCCTTCTTGTATATTATGG + Intergenic
1093741726 12:22696279-22696301 TTGTGGATTTTACCATTGTAAGG + Intergenic
1095139723 12:38646671-38646693 TTGTGCATGTATGCATATGAGGG - Intergenic
1098422175 12:70310609-70310631 TTGGCCATTTTTGAAGAGTAAGG + Intronic
1098690694 12:73483527-73483549 TTGTGGACTGGTGCATAGTAAGG - Intergenic
1098702866 12:73651552-73651574 TTGTTCTTTTTTGCTTAGGATGG - Intergenic
1098742868 12:74196971-74196993 TTGTGCATGTTTGCATATTATGG + Intergenic
1099147748 12:79068148-79068170 TTGTGCTGTTTTGCATGGTTAGG - Intronic
1099312164 12:81040398-81040420 TTGTGCATTTTTGCAGATTTTGG + Intronic
1102738352 12:115183173-115183195 GTGTGTGGTTTTGCATAGTATGG - Intergenic
1103252775 12:119515301-119515323 TTGTTGATTTTTGTATAGTATGG - Intronic
1106639098 13:31564335-31564357 TTTTGCAATTTTGAATAGCATGG + Intergenic
1108229947 13:48326907-48326929 TTGTGAATTTGTGTATTGTAGGG - Intronic
1109202795 13:59449570-59449592 TTTTATATTTTTACATAGTATGG + Intergenic
1109377784 13:61520205-61520227 TTGGGCATTTTTAAATACTATGG - Intergenic
1109402357 13:61851071-61851093 TTATGCTTTTTTGCCTAATAAGG - Intergenic
1110056044 13:70973729-70973751 TTTCACATTTTTGCATAGTCAGG + Intergenic
1110094478 13:71499387-71499409 TTTTGCATATCTGCACAGTAGGG + Intronic
1112944680 13:104913518-104913540 TTGTGGATTTTAAGATAGTAAGG - Intergenic
1113189620 13:107728993-107729015 TTGTTCATCATTGCATAGAATGG + Intronic
1114322588 14:21559497-21559519 TTTTGTATTTTTTCATAGGATGG - Intergenic
1115596662 14:34916287-34916309 TTTTGTATTTTTGCATAGATGGG + Intergenic
1118793747 14:69120595-69120617 TTGTGCATTTTAGCATAGAGTGG - Intronic
1119964412 14:78898057-78898079 TTCAGTATTTTTGCATATTAGGG - Intronic
1121614338 14:95303049-95303071 TTCTACATTTTTGCATGGTTTGG - Intronic
1124361313 15:29038424-29038446 TTGTGCATTTTTCCGTGGTATGG + Intronic
1127468035 15:59264074-59264096 TTGTGCTTTTTTTCATATTTTGG + Intronic
1127505456 15:59593616-59593638 TTGAGCATTTTTTCATAGTTTGG - Intergenic
1127616766 15:60693990-60694012 TTGTTCTTTTTTGCTTAGGATGG - Intronic
1128956479 15:71951855-71951877 ATGTGCAATTTTGAAAAGTATGG - Exonic
1131876890 15:96817193-96817215 ATGTGTATATGTGCATAGTAGGG - Intergenic
1135271677 16:21074952-21074974 TTGATCAATTTTGAATAGTAAGG - Intronic
1136097549 16:27968074-27968096 TTGCACATTTTTGCCTATTAGGG + Intronic
1137305984 16:47200352-47200374 TTGTACATTTCTACATAGTAGGG + Intronic
1137463713 16:48689148-48689170 TCTTGCTTTTTTGCATAGTGGGG + Intergenic
1137896352 16:52216897-52216919 TGGAGGACTTTTGCATAGTAAGG + Intergenic
1139793144 16:69457150-69457172 TTTTACATTTCAGCATAGTACGG + Intronic
1141801520 16:86312628-86312650 TTGTGCATTTTTGGACTGGATGG - Intergenic
1146014535 17:29222182-29222204 TTGTGCACTTTTCTATAGTATGG + Intergenic
1147209420 17:38863231-38863253 TTGTGCATTTTTTGAGGGTAGGG + Intergenic
1148204779 17:45773408-45773430 TGGTGCATTTTTACAGAGCACGG - Intergenic
1150378087 17:64698878-64698900 CTGTGCATTTTTTCACAGTGTGG - Intergenic
1150805689 17:68317078-68317100 TTGCCCATTTTTGCACAGAAAGG + Intronic
1150944824 17:69733596-69733618 TTTTGCATTTGTGCCCAGTAGGG + Intergenic
1153460688 18:5329360-5329382 TTGTGTATTTTTGAAGAGTTAGG + Intergenic
1153753122 18:8253849-8253871 TTGTGTATTTGTGCAGAATAAGG - Intronic
1154029410 18:10739254-10739276 TTCTGCATTATTGCATCATAAGG + Intronic
1155085619 18:22454817-22454839 TTGTGCAGTTTTGCTTTGAAAGG + Intergenic
1156732228 18:40207840-40207862 TTGTGGATTTTTACTTAGCAGGG - Intergenic
1156988244 18:43374985-43375007 TTGTGTATTGTTATATAGTAAGG + Intergenic
1157245309 18:46048656-46048678 TTTAGCATTTTTGAAGAGTATGG - Intronic
1157633766 18:49128840-49128862 TTGTGCATTTTTACTTACAAAGG - Intronic
1158429108 18:57367797-57367819 TTGTGCTTTTCTGCACAGTATGG - Exonic
1158790910 18:60779490-60779512 TTGTTCTTTTTTGCTTAGAATGG - Intergenic
1162892942 19:13747341-13747363 TTTTGCATTTTTAAATAGTTAGG - Intronic
1165122650 19:33570636-33570658 TTGTGGATTTTTGCTTGTTAAGG - Intergenic
1166638251 19:44471111-44471133 TTTTTCTTTTTTGCAGAGTAGGG + Intergenic
1168167879 19:54565443-54565465 TTTTGCATTTTTGTAGAGAAGGG + Intergenic
925083817 2:1091811-1091833 TTGTGCATATTTGCTTAATTTGG - Intronic
925101820 2:1253452-1253474 TTCTACATTATTGCATAGTGAGG - Intronic
927947688 2:27147134-27147156 CTGTACATTATTTCATAGTATGG + Intergenic
929131627 2:38580436-38580458 TTTTGCATGTTTGCATATTTAGG - Intronic
932146421 2:69322733-69322755 TTTTTCATCTTTGCATATTAAGG + Exonic
932922946 2:75938562-75938584 TTGTTCTTTTTTGCTTAGGATGG + Intergenic
933067337 2:77814693-77814715 ATTTGCTTTTTTGTATAGTAAGG + Intergenic
933399346 2:81773056-81773078 TTCTGCATTTTTTGATATTATGG + Intergenic
933588456 2:84205342-84205364 TTGTACAATTTTGCATAGCATGG - Intergenic
934149546 2:89132632-89132654 TTGTTCATATTTGCTTAGGACGG - Intergenic
934217749 2:90049396-90049418 TTGTTCATTTTTGCTTAGGACGG + Intergenic
937834723 2:126460795-126460817 ATGTGCATTTTAGCAAAGTGTGG - Intergenic
938917117 2:135953084-135953106 TTGCACAATTTTGCATAGGACGG + Intronic
938947085 2:136223163-136223185 TTGTGTATTTTTGGCCAGTAGGG + Intergenic
939521141 2:143232073-143232095 CTGTGCTTATTTGCACAGTAAGG - Intronic
941037543 2:160584666-160584688 TGGTGCATTTTCTCAAAGTAAGG + Intergenic
941486624 2:166089918-166089940 TAGTGCATCTTTGCACATTAAGG + Intronic
941511536 2:166416755-166416777 TTTTGCATTTTCCCATAGCATGG + Exonic
941668922 2:168270079-168270101 TTTAGAATTTTTGCATAGTGGGG + Intergenic
941697451 2:168568810-168568832 TTGTGCGATTTTGCATGGTGTGG - Intronic
941889308 2:170561510-170561532 TTGTGCATTTTTCTAGAGTTAGG - Intronic
942159663 2:173169946-173169968 TTAAGCATTTTAGCATATTAAGG - Intronic
942309180 2:174638471-174638493 TGGTGCACTCTTGCACAGTAGGG - Intronic
942944019 2:181653826-181653848 TGGTGTTTTGTTGCATAGTATGG + Intronic
944361526 2:198862815-198862837 TTATACATTTTTTCAAAGTATGG - Intergenic
945565568 2:211394356-211394378 TTCTGCATTTTTGTATTGTTTGG + Intronic
1170392776 20:15893484-15893506 CTTTGCATTTTTGCATTGAATGG + Intronic
1173243945 20:41321257-41321279 TTCTTGATTTCTGCATAGTAGGG + Intergenic
1173563744 20:44024514-44024536 CTGTACATTTTTTCTTAGTATGG + Intronic
1173615380 20:44400131-44400153 TTGTGCATTTTTGTTTTGGACGG - Intronic
1177038661 21:16077801-16077823 TAGTGCATTTTTGCAAAGGATGG + Intergenic
1181592044 22:23891525-23891547 TTATGCATCTGTGCATAATAGGG - Intronic
1182637805 22:31742714-31742736 TTGTGCATGTATGCATATGAGGG - Intronic
1183767856 22:39895844-39895866 TTGTCTATATTTGCATAGTCAGG + Intergenic
949487699 3:4555650-4555672 TTGAGGATTATTCCATAGTATGG + Intronic
950089116 3:10282611-10282633 TTGTTCATTTTTGTAAAGTAAGG + Intronic
951674898 3:25227428-25227450 TTGTGAATTTTGGCAGAGTGGGG - Intronic
953655827 3:44853787-44853809 TTGAACATTTTTCCATATTATGG + Intronic
953779846 3:45858282-45858304 TTGTGGAATTTTTCAGAGTAAGG - Intronic
957411733 3:79850019-79850041 TTATGCATTTTTGACCAGTAGGG + Intergenic
958479388 3:94627473-94627495 TTCTGCATTTTTGCATTTTAAGG + Intergenic
958584300 3:96067501-96067523 TTGTGTATTTTTGTATATTTTGG - Intergenic
958644154 3:96847709-96847731 TTATGTATTTTTGCATACTTTGG + Intronic
959076746 3:101756838-101756860 GTGTGTATGTGTGCATAGTAGGG + Intronic
960146915 3:114213200-114213222 TTGTGCAGTTTTGAATAAGATGG - Intergenic
960509304 3:118529432-118529454 TTGGGCATTTTTTTATAGCAGGG - Intergenic
961233936 3:125347308-125347330 TTGTCCATTTCTGCAAAGAAAGG - Intronic
962172146 3:133112852-133112874 TTGCACAATTTTGCATAGCATGG - Intronic
962656926 3:137556433-137556455 TTGAGCATTTTTGCATCATCAGG - Intergenic
963421222 3:145062913-145062935 TTGTACAATTTAGCATAGTGGGG + Intergenic
963842465 3:150121664-150121686 TTGTGCATTTTTTCATATGTAGG + Intergenic
966621947 3:181974846-181974868 TGGTGTTTTATTGCATAGTAGGG - Intergenic
967015677 3:185479526-185479548 ATGTACATATATGCATAGTATGG - Intronic
967976552 3:195038185-195038207 TTGAGCATTTTTTCATATGATGG + Intergenic
968256000 3:197272490-197272512 TTGTGCCATTTTTCATAGTGTGG + Intronic
968683902 4:1943161-1943183 GTCCGCATTTTTGCATGGTAAGG + Intronic
970963564 4:21901615-21901637 TTGTTCATTTTTGCAAAATGTGG - Intronic
973538487 4:51909395-51909417 TTGTGGATTGCTTCATAGTATGG + Intronic
973617871 4:52697452-52697474 TTGTTTGTTTTTGCTTAGTATGG - Intergenic
973651205 4:52998730-52998752 TTTTTCATTTTTGCAGAGTCAGG - Intronic
973656407 4:53052787-53052809 TTGTGTAGTATTGCATTGTATGG - Intronic
976426421 4:84908400-84908422 TTCTGAATATTTGCATATTATGG - Intronic
977289945 4:95154177-95154199 CTGTGTTTGTTTGCATAGTATGG + Intronic
977562607 4:98547699-98547721 TTGTGCATTTTTCCTGAGTAAGG - Intronic
977874982 4:102139029-102139051 TTCTGTATTTTTGCATAATCAGG - Intergenic
978437815 4:108704551-108704573 GTGTGAAATTTTGGATAGTATGG + Intergenic
978590665 4:110321487-110321509 TTGAGTAGTTTTCCATAGTATGG + Intergenic
979064182 4:116106873-116106895 TTTTGCATTTTTTCTTAATATGG + Intergenic
979457080 4:120939373-120939395 TTTTGCATTTTTGTAGAGAAGGG - Intergenic
982628493 4:157800639-157800661 AAGTACATTTTTGCAGAGTATGG + Intergenic
983801904 4:171941785-171941807 TTGTGAATTTTTGCTTAGAAGGG - Intronic
983850419 4:172573203-172573225 GTGTGCATTCATGCAGAGTAGGG - Intronic
986143733 5:5056760-5056782 ATGTGCCTTTTTGCATAATTGGG - Intergenic
986370549 5:7076005-7076027 TTGTGCAGGTTTTCAGAGTATGG + Intergenic
986453712 5:7893348-7893370 TTGTCCAATTTTGGCTAGTAGGG + Intronic
989283806 5:39675478-39675500 ATGTGCGTTTTTGCAGATTAGGG + Intergenic
989405357 5:41055193-41055215 AAATTCATTTTTGCATAGTATGG - Intronic
990367323 5:55084557-55084579 TGGTGCATTTTTACAGAGTGCGG + Intergenic
991608972 5:68431091-68431113 TTGTGCATTTTTGATTGGTGGGG + Intergenic
992210652 5:74476589-74476611 GTGTGCATATTTGCATGGGAGGG - Intergenic
992550203 5:77852442-77852464 TTTTGCATATTTGCATAATGAGG + Intronic
993940231 5:94049367-94049389 TTATTCATTCTGGCATAGTAGGG + Intronic
995357203 5:111252357-111252379 TTATACATTTTTGTTTAGTATGG + Intronic
995767193 5:115631731-115631753 TTGTGTATTTAAGCATAGAAAGG - Intronic
997023646 5:130032371-130032393 TTGTGCCTGTTTGGATAATAAGG + Intronic
997648486 5:135497576-135497598 TTTTCCACTTTTGAATAGTAAGG - Intergenic
997964393 5:138345903-138345925 TTGTGCATTCTTGGAAAGGAGGG - Intronic
1000120031 5:158188558-158188580 TTGGGCATGTTTGCTTAGAAAGG - Intergenic
1000437166 5:161226468-161226490 TTGTATATTTTTCCATAGCATGG - Intergenic
1000692476 5:164340789-164340811 TTGTTCAATTTTGCAGAGTTTGG + Intergenic
1010505710 6:76656535-76656557 TTCTGCTTTATTGGATAGTAGGG - Intergenic
1014535224 6:122606399-122606421 TTTTGCATTTTTGCAGAGACGGG - Intronic
1014899516 6:126945637-126945659 TTGTGCATTTCTGCATTTTTTGG - Intergenic
1014972150 6:127829878-127829900 TTGTGATTTCTTCCATAGTAAGG + Exonic
1016445712 6:144130001-144130023 GTGTGCATTTTTGATTAGGAAGG - Intergenic
1016501253 6:144723503-144723525 TTGTGAGTTCTTGCATGGTAAGG - Intronic
1018247951 6:161840302-161840324 TTGTGCATTATTGCAAAGACCGG + Intronic
1020427318 7:8083287-8083309 TTGTTGCTGTTTGCATAGTAAGG + Intronic
1020504277 7:8963793-8963815 TTGTGCAATTGTGCTTAGTGGGG + Intergenic
1020879442 7:13740978-13741000 TTGTCTATTTTTGTAAAGTAAGG + Intergenic
1021247229 7:18278747-18278769 TTGTGAATTTATGCATATGAAGG + Intronic
1021630127 7:22636872-22636894 TTGAGCTTTATTGCATAGTGTGG - Intergenic
1023554249 7:41403690-41403712 TTATGCATTTATGCATAATTAGG + Intergenic
1025604757 7:63031413-63031435 ATATGCATTTTTAAATAGTAGGG + Intergenic
1026315027 7:69220496-69220518 GTGTGCATTTTTTTAAAGTAGGG - Intergenic
1026383098 7:69818950-69818972 TTCTGAATTTTTGCTGAGTAGGG + Intronic
1027727112 7:81821387-81821409 GTGTGTATGTGTGCATAGTAAGG + Intergenic
1028308485 7:89297795-89297817 ATGTGCACTTTTGAAGAGTAAGG + Intronic
1029788921 7:102822050-102822072 TTGTGCAGTATTGCATCTTAAGG + Exonic
1029976640 7:104841173-104841195 TTGTGCATTTTTCTATAAGATGG - Intronic
1030002146 7:105076423-105076445 ATTTGCACTTTTGCATAGTTGGG + Intronic
1031167822 7:118251566-118251588 TTTTGCATTTTTTCATATTCAGG + Intergenic
1031384887 7:121137340-121137362 TTATGCAATTTTGTATAGAAAGG + Intronic
1032808786 7:135386677-135386699 TTCTAAATTTTTGCATAGAATGG - Intronic
1034959230 7:155354202-155354224 TTCTCTATTTTGGCATAGTAAGG + Intergenic
1036066117 8:5383433-5383455 TTGTCCATTATTTCGTAGTAAGG - Intergenic
1036141088 8:6209065-6209087 TTGTGCAATTTTGTATAATGAGG - Intergenic
1037856217 8:22372431-22372453 CTGTGTAGTATTGCATAGTATGG + Intronic
1038562196 8:28590191-28590213 TTTTGCATTTCTGCATAGTGTGG - Intergenic
1040971829 8:53143453-53143475 TGGTGCATTTTTACAAAGCATGG + Intergenic
1041704733 8:60834298-60834320 TTGTGGATTTTAACTTAGTATGG + Intronic
1042636009 8:70876078-70876100 TTATGCTTTATTTCATAGTATGG - Intergenic
1042756890 8:72224448-72224470 TTGTGCATATTTGTCTTGTATGG + Intergenic
1044080922 8:87882713-87882735 ATGTACATTTTTGCATAATTTGG - Intergenic
1047460510 8:125059692-125059714 TTGTGCATTTTTTAATAGCTTGG - Intronic
1050414343 9:5399467-5399489 TTGTGCATTTTTAGATTGTCCGG + Intronic
1050868214 9:10531356-10531378 TTGTGCATTTTTGCATAGTATGG - Intronic
1052290088 9:26830314-26830336 TGGTGCGTTTTTACAGAGTATGG - Intergenic
1055699299 9:78925156-78925178 TTGTGTGCTTTGGCATAGTAAGG - Intergenic
1056113949 9:83423765-83423787 TTTTGTATTTTTGCAGAGTTGGG + Intronic
1059539145 9:115113368-115113390 TTGTGCATATTTGAATAGGGTGG + Intronic
1059951706 9:119470387-119470409 TAGTTGATTTTTGCATAGGATGG + Intergenic
1060170576 9:121457852-121457874 TTGTGCATATTTCCATATCAAGG - Intergenic
1060339231 9:122758993-122759015 TTGTGTATCTTAGCATTGTATGG - Intergenic
1060451937 9:123750830-123750852 CTGTGCATTTTTGTATAGCAGGG + Intronic
1185651653 X:1652318-1652340 TTCTGCATTTTTTTCTAGTATGG + Intergenic
1186118054 X:6325969-6325991 TTGGGCATTTTTACATGGTTTGG - Intergenic
1187262629 X:17701347-17701369 TTGTGCAATTTTGTACAGTGTGG - Intronic
1188003317 X:25001863-25001885 TTTTGCCTTTTTGTTTAGTAGGG - Intergenic
1188280505 X:28262453-28262475 TTTTGCATTTTTTCATATTCTGG - Intergenic
1188770643 X:34149121-34149143 TTCTGAATTTTTGCTTAGGAAGG + Intergenic
1189089379 X:38063633-38063655 TTTTGTATTTTTGAATATTATGG + Intronic
1189147390 X:38669025-38669047 TGGTGTTTTATTGCATAGTAGGG + Intronic
1189783093 X:44534975-44534997 TTTTGTATTTTTGTATAATAGGG - Intronic
1189867399 X:45345546-45345568 TTCAGAATTTTTGCATAGAAGGG + Intergenic
1190857366 X:54309701-54309723 TTTTGCATTTTGGCATAGACGGG + Intronic
1191710474 X:64145006-64145028 TTATGCATAGTTGCATAGTAAGG + Intergenic
1191801976 X:65091768-65091790 TTGTGCATATGTGCATACAAGGG + Intergenic
1192986346 X:76403206-76403228 TTGTATCTTTTTGCATTGTATGG - Intergenic
1195441068 X:104898523-104898545 TTCTGCATTTCTGCATTGCATGG + Intronic
1195753947 X:108182548-108182570 TAGAGCATATTTCCATAGTAGGG - Intronic
1196221789 X:113119657-113119679 CTGTGCATTTCTCCACAGTAAGG - Intergenic
1196484326 X:116187262-116187284 TGGTCCATTTTTGTGTAGTAAGG + Intergenic
1196713166 X:118784969-118784991 TTGTGATTTTTTGCAGTGTATGG + Intronic
1197182504 X:123551555-123551577 TTGTGCTTTTTGAGATAGTAGGG - Intergenic
1197453699 X:126650444-126650466 TTGTGCTTTTTTTCTGAGTAGGG + Intergenic
1198012605 X:132574012-132574034 TTTTTCATTTCTGCATAGTCAGG + Intergenic
1198828841 X:140727606-140727628 TTGTGAATTTTTGCACTGTGAGG - Intergenic
1199001170 X:142638396-142638418 TTTTGCTTTTTAGCATAGTTTGG + Intergenic
1199279598 X:145985155-145985177 TTTTGCATGTTTGCATAAGAAGG - Intergenic
1199311652 X:146328103-146328125 TTGTGCAGTATTACATTGTATGG + Intergenic
1199467405 X:148154484-148154506 TTCTGCATTTTTGCATGTTGTGG + Intergenic