ID: 1050868220

View in Genome Browser
Species Human (GRCh38)
Location 9:10531384-10531406
Sequence ACATAGGGATGATGGGGAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050868214_1050868220 5 Left 1050868214 9:10531356-10531378 CCATACTATGCAAAAATGCACAA 0: 1
1: 0
2: 1
3: 21
4: 242
Right 1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG No data
1050868213_1050868220 16 Left 1050868213 9:10531345-10531367 CCTAAAAATCACCATACTATGCA 0: 1
1: 3
2: 9
3: 33
4: 234
Right 1050868220 9:10531384-10531406 ACATAGGGATGATGGGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050868220 Original CRISPR ACATAGGGATGATGGGGAAA TGG Intronic
No off target data available for this crispr