ID: 1050869712

View in Genome Browser
Species Human (GRCh38)
Location 9:10551531-10551553
Sequence GAATTGTGCCTTTGTAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050869708_1050869712 3 Left 1050869708 9:10551505-10551527 CCTGAAGAAGAAGGCCTCATGAA 0: 1
1: 0
2: 4
3: 18
4: 210
Right 1050869712 9:10551531-10551553 GAATTGTGCCTTTGTAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050869712 Original CRISPR GAATTGTGCCTTTGTAAAAC AGG Intronic
No off target data available for this crispr