ID: 1050877755

View in Genome Browser
Species Human (GRCh38)
Location 9:10661331-10661353
Sequence GTGATGTGAAGGAGGTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1050877752_1050877755 16 Left 1050877752 9:10661292-10661314 CCAATTATTAGGATTCATTACAG No data
Right 1050877755 9:10661331-10661353 GTGATGTGAAGGAGGTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1050877755 Original CRISPR GTGATGTGAAGGAGGTTGTG AGG Intergenic
No off target data available for this crispr